offTargetAnalysisWithoutBSgenome: Design of target-specific guide RNAs for CRISPR-Cas9 system...
In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems
View source: R/offTargetAnalysisWithoutBSgenome.R
offTargetAnalysisWithoutBSgenome R Documentation
Design of target-specific guide RNAs for CRISPR-Cas9 system in one function
without BSgenome
Description
Design of target-specific guide RNAs (gRNAs) for CRISPR-Cas9 system without
BSgenome by automatically calling findgRNAs, filtergRNAs, searchHits,
buildFeatureVectorForScoring, getOfftargetScore, filterOfftarget,
calculating gRNA cleavage efficiency and generate reports.
Usage
offTargetAnalysisWithoutBSgenome(
inputFilePath,
format = "fasta",
header = FALSE,
gRNAoutputName,
findgRNAs = TRUE,
exportAllgRNAs = c("all", "fasta", "genbank", "no"),
findgRNAsWithREcutOnly = FALSE,
REpatternFile = system.file("extdata", "NEBenzymes.fa", package = "CRISPRseek"),
minREpatternSize = 4,
overlap.gRNA.positions = c(17, 18),
findPairedgRNAOnly = FALSE,
annotatePaired = TRUE,
paired.orientation = c("PAMout", "PAMin"),
enable.multicore = FALSE,
n.cores.max = 6,
min.gap = 0,
max.gap = 20,
gRNA.name.prefix = "",
PAM.size = 3,
gRNA.size = 20,
PAM = "NGG",
BSgenomeName,
chromToSearch = "all",
chromToExclude = c("chr17_ctg5_hap1", "chr4_ctg9_hap1", "chr6_apd_hap1",
"chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5", "chr6_qbl_hap6",
"chr6_ssto_hap7"),
max.mismatch = 3,
PAM.pattern = "NNG$|NGN$",
allowed.mismatch.PAM = 1,
gRNA.pattern = "",
baseEditing = FALSE,
targetBase = "C",
editingWindow = 4:8,
editingWindow.offtargets = 4:8,
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.score = 0,
topN = 1000,
topN.OfftargetTotalScore = 10,
annotateExon = TRUE,
txdb,
orgAnn,
ignore.strand = TRUE,
outputDir,
fetchSequence = TRUE,
upstream = 200,
downstream = 200,
upstream.search = 0,
downstream.search = 0,
weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613,
0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583),
baseBeforegRNA = 4,
baseAfterPAM = 3,
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv", package =
"CRISPRseek"),
useScore = TRUE,
useEfficacyFromInputSeq = FALSE,
outputUniqueREs = TRUE,
foldgRNAs = FALSE,
gRNA.backbone = "GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU",
temperature = 37,
overwrite = FALSE,
scoring.method = c("Hsu-Zhang", "CFDscore"),
subPAM.activity = hash(AA = 0, AC = 0, AG = 0.259259259, AT = 0, CA = 0, CC = 0, CG =
0.107142857, CT = 0, GA = 0.069444444, GC = 0.022222222, GG = 1, GT = 0.016129032, TA
= 0, TC = 0, TG = 0.038961039, TT = 0),
subPAM.position = c(22, 23),
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc,
mismatch.activity.file = system.file("extdata",
"NatureBiot2016SuppTable19DoenchRoot.csv", package = "CRISPRseek"),
useBSgenome = FALSE,
genomeSeqFile,
predIndelFreq = FALSE,
predictIndelFreq.onTargetOnly = TRUE,
method.indelFreq = "Lindel",
baseBeforegRNA.indelFreq = 13,
baseAfterPAM.indelFreq = 24
)
Arguments
inputFilePath
Sequence input file path or a DNAStringSet object that
contains sequences to be searched for potential gRNAs
format
Format of the input file, fasta, fastq and bed are supported,
default fasta
header
Indicate whether the input file contains header, default
FALSE, only applies to bed format
gRNAoutputName
Specify the name of the gRNA outupt file when
inputFilePath is DNAStringSet object instead of file path
findgRNAs
Indicate whether to find gRNAs from the sequences in the
input file or skip the step of finding gRNAs, default TRUE. Set it to FALSE
if the input file contains user selected gRNAs plus PAM already.
exportAllgRNAs
Indicate whether to output all potential gRNAs to a
file in fasta format, genbank format or both. Default to both.
findgRNAsWithREcutOnly
Indicate whether to find gRNAs overlap with
restriction enzyme recognition pattern
REpatternFile
File path containing restriction enzyme cut patterns
minREpatternSize
Minimum restriction enzyme recognition pattern
length required for the enzyme pattern to be searched for, default 4
overlap.gRNA.positions
The required overlap positions of gRNA and
restriction enzyme cut site, default 17 and 18
findPairedgRNAOnly
Choose whether to only search for paired gRNAs in
such an orientation that the first one is on minus strand called reverse
gRNA and the second one is on plus strand called forward gRNA. TRUE or
FALSE, default FALSE
annotatePaired
Indicate whether to output paired information, default
TRUE
paired.orientation
PAMin orientation means the two adjacent PAMs on
the sense and antisense strands face inwards towards each other like N21GG
and CCN21 whereas PAMout orientation means they face away from each other
like CCN21 and N21GG
enable.multicore
Indicate whether enable parallel processing, default
FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE
n.cores.max
Indicating maximum number of cores to use in multi core
mode, i.e., parallel processing, default 6. Please set it to 1 to disable
multicore processing for small dataset.
min.gap
Minimum distance between two oppositely oriented gRNAs to be
valid paired gRNAs. Default 0
max.gap
Maximum distance between two oppositely oriented gRNAs to be
valid paired gRNAs. Default 20
gRNA.name.prefix
The prefix used when assign name to found gRNAs,
default gRNA, short for guided RNA.
PAM.size
PAM length, default 3
gRNA.size
The size of the gRNA, default 20
PAM
PAM sequence after the gRNA, default NGG
BSgenomeName
BSgenome object. Please refer to available.genomes in
BSgenome package. For example,
BSgenome.Hsapiens.UCSC.hg19 - for hg19,
BSgenome.Mmusculus.UCSC.mm10 - for mm10
BSgenome.Celegans.UCSC.ce6 - for ce6
BSgenome.Rnorvegicus.UCSC.rn5 - for rn5
BSgenome.Drerio.UCSC.danRer7 - for Zv9
BSgenome.Dmelanogaster.UCSC.dm3 - for dm3
chromToSearch
Specify the chromosome to search, default to all,
meaning search all chromosomes. For example, chrX indicates searching for
matching in chromosome X only
chromToExclude
Specify the chromosome not to search. If specified as
"", meaning to search chromosomes specified by chromToSearch. By default, to
exclude haplotype blocks from offtarget search in hg19, i.e., chromToExclude
= c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1", "chr6_cox_hap2",
"chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6",
"chr6_ssto_hap7")
max.mismatch
Maximum mismatch allowed in off target search, default
3. Warning: will be considerably slower if set > 3
PAM.pattern
Regular expression of protospacer-adjacent motif (PAM),
default NNG$|NGN$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM
sequence
allowed.mismatch.PAM
Maximum number of mismatches allowed in the PAM
sequence for offtarget search, default to 1 for NNG or NGN PAM pattern for
offtarget finding.
gRNA.pattern
Regular expression or IUPAC Extended Genetic Alphabet to
represent gRNA pattern, default is no restriction. To specify that the gRNA
must start with GG for example, then set it to ^GG. Please see
help(translatePattern) for a list of IUPAC Extended Genetic Alphabet.
baseEditing
Indicate whether to design gRNAs for base editing.
Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and
editingWidow accordingly.
targetBase
Applicable only when baseEditing is set to TRUE. It is
used to indicate the target base for base editing systems, default to C for
converting C to T in the CBE system. Please change it to A if you intend to
use the ABE system.
editingWindow
Applicable only when baseEditing is set to TRUE. It is
used to indicate the effective editing window, default to 4 to 8 which is
for the original CBE system. Please change it accordingly if the system you
use have a different editing window.
editingWindow.offtargets
Applicable only when baseEditing is set to
TRUE. It is used to indicate the effective editing window to consider for
the offtargets search only, default to 4 to 8 (1 means the most distal site
from the 3' PAM, the most proximla site from the 5' PAM), which is for the
original CBE system. Please change it accordingly if the system you use
have a different editing window, or you would like to include offtargets
with the target base in a larger editing window.
primeEditing
Indicate whether to design gRNAs for prime editing.
Default to FALSE. If true, please set PBS.length, RT.template.length,
RT.template.pattern, targeted.seq.length.change, bp.after.target.end,
target.start, and target.end accordingly
PBS.length
Applicable only when primeEditing is set to TRUE. It is
used to specify the number of bases to ouput for primer binding site.
RT.template.length
Applicable only when primeEditing is set to TRUE.
It is used to specify the number of bases required for RT template, default
to 8 to 18. Please increase the length if the edit is large insertion. Only
gRNAs with calculated RT.template.length falling into the specified range
will be in the output. It is calculated as the following. RT.template.length
= target.start – cut.start + (target.end - target.start) +
targeted.seq.length.change + bp.after.target.end
RT.template.pattern
Applicable only when primeEditing is set to TRUE.
It is used to specify the RT template sequence pattern, default to not
ending with C according to https://doi.org/10.1038/s41586-019-1711-4
corrected.seq
Applicable only when primeEditing is set to TRUE. It is
used to specify the mutated or inserted sequences after successful editing.
targeted.seq.length.change
Applicable only when primeEditing is set
to TRUE. It is used to specify the number of targeted sequence length
change. Please set it to 0 for base changes, positive numbers for insersion,
and negative number for deletion. For example, 10 means that the corrected
sequence will have 10bp insertion, -10 means that the corrected sequence
will have 10bp deletion, and 0 means only bases have been changed and the
sequence length remains the same
bp.after.target.end
Applicable only when primeEditing is set to TRUE.
It is used to specify the number of bases to add after the target change end
site as part of RT template. Please refer to RT.template.length for how this
parameter influences the RT.template.length calculation which is used as a
filtering criteria in pregRNA selection.
target.start
Applicable only when primeEditing is set to TRUE. It is
used to specify the start location in the input sequence to make changes,
which will be used to obtain the RT template sequence. Please also refer to
RT.template.length for how this parameter influences the RT.template.length
calculation which is used as a filtering criteria in pregRNA selection.
target.end
Applicable only when primeEditing is set to TRUE. It is
used to specify the end location in the input sequnence to make changes,
which will be used to obtain the RT template sequence. Please also refer to
RT.template.length for how this parameter influences the RT.template.length
calculation which is used as a filtering criteria in pregRNA selection.
primeEditingPaired.output
Applicable only when primeEditing is set to
TRUE. It is used to specify the file path to save pegRNA and the second gRNA
with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls
min.score
minimum score of an off target to included in the final
output, default 0
topN
top N off targets to be included in the final output, default
1000
topN.OfftargetTotalScore
top N off target used to calculate the total
off target score, default 10
annotateExon
Choose whether or not to indicate whether the off target
is inside an exon or not, default TRUE
txdb
TxDb object, for creating and using TxDb object, please refer to
GenomicFeatures package. For a list of existing TxDb object, please search
for annotation package starting with Txdb at
http://www.bioconductor.org/packages/release/BiocViews.html#___AnnotationData,
such as
TxDb.Rnorvegicus.UCSC.rn5.refGene - for rat
TxDb.Mmusculus.UCSC.mm10.knownGene - for mouse
TxDb.Hsapiens.UCSC.hg19.knownGene - for human
TxDb.Dmelanogaster.UCSC.dm3.ensGene - for Drosophila
TxDb.Celegans.UCSC.ce6.ensGene - for C.elegans
orgAnn
organism annotation mapping such as org.Hs.egSYMBOL in
org.Hs.eg.db package for human
ignore.strand
default to TRUE when annotating to gene
outputDir
the directory where the off target analysis and reports
will be written to
fetchSequence
Fetch flank sequence of off target or not, default TRUE
upstream
upstream offset from the off target start, default 200
downstream
downstream offset from the off target end, default 200
upstream.search
upstream offset from the bed input starts to search
for gRNAs, default 0
downstream.search
downstream offset from the bed input ends to search
for gRNAs, default 0
weights
Applicable only when scoring.method is set to Hsu-Zhang a
numeric vector size of gRNA length, default c(0, 0, 0.014, 0, 0, 0.395,
0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615,
0.804, 0.685, 0.583) which is used in Hsu et al., 2013 cited in the
reference section
baseBeforegRNA
Number of bases before gRNA used for calculating gRNA
efficiency, default 4 Please note, for PAM located on the 5 prime, need to
specify the number of bases before the PAM sequence plus PAM size.
baseAfterPAM
Number of bases after PAM used for calculating gRNA
efficiency, default 3 for spCas9 Please note, for PAM located on the 5
prime, need to include the length of the gRNA plus the extended sequence on
the 3 prime
featureWeightMatrixFile
Feature weight matrix file used for
calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used.
To use alternative weight matrix file, please input a csv file with first
column containing significant features and the second column containing the
corresponding weights for the features. Please see Doench et al., 2014 for
details.
useScore
Default TRUE, display in gray scale with the darkness
indicating the gRNA efficacy. The taller bar shows the Cas9 cutting site.
If set to False, efficacy will not show. Instead, gRNAs in plus strand will
be colored red and gRNAs in negative strand will be colored green.
useEfficacyFromInputSeq
Default FALSE. If set to TRUE, summary file
will contain gRNA efficacy calculated from input sequences instead of from
off-target analysis. Set it to TRUE if the input sequence is from a
different species than the one used for off-target analysis.
outputUniqueREs
Default TRUE. If set to TRUE, summary file will
contain REs unique to the cleavage site within 100 or 200 bases surrounding
the gRNA sequence.
foldgRNAs
Default FALSE. If set to TRUE, summary file will contain
minimum free energy of the secondary structure of gRNA with gRNA backbone
from GeneRfold package provided that GeneRfold package has been installed.
gRNA.backbone
gRNA backbone constant region sequence. Default to the
sequence in Sp gRNA backbone.
temperature
temperature in celsius. Default to 37 celsius.
overwrite
overwrite the existing files in the output directory or
not, default FALSE
scoring.method
Indicates which method to use for offtarget cleavage
rate estimation, currently two methods are supported, Hsu-Zhang and CFDscore
subPAM.activity
Applicable only when scoring.method is set to
CFDscore A hash to represent the cleavage rate for each alternative sub PAM
sequence relative to preferred PAM sequence
subPAM.position
Applicable only when scoring.method is set to
CFDscore The start and end positions of the sub PAM. Default to 22 and 23
for spCas9 with 20bp gRNA and NGG as preferred PAM. For Cpf1, it could be
c(1,2).
PAM.location
PAM location relative to gRNA. For example, default to
3prime for spCas9 PAM. Please set to 5prime for cpf1 PAM since it's PAM is
located on the 5 prime end
rule.set
Specify a rule set scoring system for calculating gRNA
efficacy. Please note that Root_RuleSet2_2016 requires the following python
packages with specified verion and python 2.7. 1. scikit-learn 0.16.1 2.
pickle 3. pandas 4. numpy 5. scipy
chrom_acc
Optional binary variable indicating chromatin accessibility
information with 1 indicating accessible and 0 not accessible.
mismatch.activity.file
Applicable only when scoring.method is set to
CFDscore A comma separated (csv) file containing the cleavage rates for all
possible types of single nucleotide mismatche at each position of the gRNA.
By default, using the supplemental Table 19 from Doench et al., Nature
Biotechnology 2016
useBSgenome
Specify whether BSgenome is avaialbe for searching for
gRNA and offtargets, default to FALSE. If set it to TRUE, the results should
be the same as when using offtargetAnalysis function.
genomeSeqFile
Specify the genome sequence file in fasta format. It is
only applicable and required when useBSgenome is set to FALSE.
predIndelFreq
Default to FALSE. Set it to TRUE to output the
predicted indels and their frequencies.
predictIndelFreq.onTargetOnly
Default to TRUE, indicating that indels
and their frequencies will be predicted for ontargets only. Usually,
researchers are only interested in predicting the editing outcome for the
ontargets since any editing in the offtargets are unwanted. Set it to FALSE
if you are interested in predicting indels and their frequencies for
offtargets. It will take longer time to run if you set it to FALSE.
method.indelFreq
Currently only Lindel method has been implemented.
Please let us know if you think additional methods should be made available.
Lindel is compatible with both Python2.7 and Python3.5 or higher. Please
type help(predictRelativeFreqIndels) to get more details.
baseBeforegRNA.indelFreq
Default to 13 for Lindel method.
baseAfterPAM.indelFreq
Default to 24 for Lindel method.
Value
Four tab delimited files are generated in the output directory:
OfftargetAnalysis.xls
- detailed information of off targets
Summary.xls
- summary of the gRNAs
REcutDetails.xls
- restriction enzyme cut sites of each gRNA
pairedgRNAs.xls
- potential paired gRNAs
Author(s)
Lihua Julie Zhu
References
Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran,
Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao & Feng Zhang
(2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
Biotechnology 31:827-834
Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M,
Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for
CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi:
10.1038 nbt.3026
Lihua Julie Zhu, Benjamin R. Holmes, Neil Aronin and Michael Brodsky.
CRISPRseek: a Bioconductor package to identify target-specific guide RNAs
for CRISPR-Cas9 genome-editing systems. Plos One Sept 23rd 2014
Moreno-Mateos, M., Vejnar, C., Beaudoin, J. et al. CRISPRscan: designing
highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods 12,
982–988 (2015) doi:10.1038/nmeth.3543
Doench JG et al., Optimized sgRNA design to maximize activity and minimize
off-target effects of CRISPR-Cas9. Nature Biotechnology Jan 18th 2016
Anzalone et al., Search-and-replace genome editing without double-strand
breaks or donor DNA. Nature October 2019
https://www.nature.com/articles/s41586-019-1711-4
Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel
profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated
double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05
September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487
See Also
CRISPRseek
Examples
library(CRISPRseek)
inputFilePath <- system.file("extdata", "inputseqWithoutBSgenome.fa",
package = "CRISPRseek")
########### genomeSeq.fasta contains the genomic sequence in fasta format for gRNA and offtarget search###############
genomeSeqFile <- system.file("extdata", "genomeSeq.fasta",
package = "CRISPRseek")
library(hash)
subPAM.activity <- hash(AA = 0, AC = 0, AG = 0.259259259,
AT = 0, CA = 0, CC = 0, CG = 0.107142857, CT = 0, GA = 0.069444444,
GC = 0.022222222, GG = 1, GT = 0.016129032, TA = 0, TC = 0,
TG = 0.038961039, TT = 0)
featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
package = "CRISPRseek")
results <- offTargetAnalysisWithoutBSgenome(inputFilePath = inputFilePath,
format = "fasta",
useBSgenome = FALSE,
genomeSeqFile = genomeSeqFile,
findgRNAs = TRUE,
exportAllgRNAs = "fasta",
fetchSequence = FALSE,
findgRNAsWithREcutOnly = FALSE,
findPairedgRNAOnly = FALSE,
annotatePaired = FALSE,
max.mismatch = 1,
annotateExon = FALSE,
scoring.method = "CFDscore",
min.score = 0.01,
PAM = "NGG",
PAM.pattern <- "NNN",
rule.set = "CRISPRscan",
featureWeightMatrixFile = featureWeightMatrixFile,
subPAM.activity = subPAM.activity,
outputDir = "gRNAoutput-CRISPRseek-CRISPRscan-CFDscore", overwrite = TRUE)
LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
View source: R/offTargetAnalysisWithoutBSgenome.R
| offTargetAnalysisWithoutBSgenome | R Documentation |
Design of target-specific guide RNAs for CRISPR-Cas9 system in one function without BSgenome
Description
Design of target-specific guide RNAs (gRNAs) for CRISPR-Cas9 system without BSgenome by automatically calling findgRNAs, filtergRNAs, searchHits, buildFeatureVectorForScoring, getOfftargetScore, filterOfftarget, calculating gRNA cleavage efficiency and generate reports.
Usage
offTargetAnalysisWithoutBSgenome(
inputFilePath,
format = "fasta",
header = FALSE,
gRNAoutputName,
findgRNAs = TRUE,
exportAllgRNAs = c("all", "fasta", "genbank", "no"),
findgRNAsWithREcutOnly = FALSE,
REpatternFile = system.file("extdata", "NEBenzymes.fa", package = "CRISPRseek"),
minREpatternSize = 4,
overlap.gRNA.positions = c(17, 18),
findPairedgRNAOnly = FALSE,
annotatePaired = TRUE,
paired.orientation = c("PAMout", "PAMin"),
enable.multicore = FALSE,
n.cores.max = 6,
min.gap = 0,
max.gap = 20,
gRNA.name.prefix = "",
PAM.size = 3,
gRNA.size = 20,
PAM = "NGG",
BSgenomeName,
chromToSearch = "all",
chromToExclude = c("chr17_ctg5_hap1", "chr4_ctg9_hap1", "chr6_apd_hap1",
"chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5", "chr6_qbl_hap6",
"chr6_ssto_hap7"),
max.mismatch = 3,
PAM.pattern = "NNG$|NGN$",
allowed.mismatch.PAM = 1,
gRNA.pattern = "",
baseEditing = FALSE,
targetBase = "C",
editingWindow = 4:8,
editingWindow.offtargets = 4:8,
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.score = 0,
topN = 1000,
topN.OfftargetTotalScore = 10,
annotateExon = TRUE,
txdb,
orgAnn,
ignore.strand = TRUE,
outputDir,
fetchSequence = TRUE,
upstream = 200,
downstream = 200,
upstream.search = 0,
downstream.search = 0,
weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613,
0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583),
baseBeforegRNA = 4,
baseAfterPAM = 3,
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv", package =
"CRISPRseek"),
useScore = TRUE,
useEfficacyFromInputSeq = FALSE,
outputUniqueREs = TRUE,
foldgRNAs = FALSE,
gRNA.backbone = "GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU",
temperature = 37,
overwrite = FALSE,
scoring.method = c("Hsu-Zhang", "CFDscore"),
subPAM.activity = hash(AA = 0, AC = 0, AG = 0.259259259, AT = 0, CA = 0, CC = 0, CG =
0.107142857, CT = 0, GA = 0.069444444, GC = 0.022222222, GG = 1, GT = 0.016129032, TA
= 0, TC = 0, TG = 0.038961039, TT = 0),
subPAM.position = c(22, 23),
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc,
mismatch.activity.file = system.file("extdata",
"NatureBiot2016SuppTable19DoenchRoot.csv", package = "CRISPRseek"),
useBSgenome = FALSE,
genomeSeqFile,
predIndelFreq = FALSE,
predictIndelFreq.onTargetOnly = TRUE,
method.indelFreq = "Lindel",
baseBeforegRNA.indelFreq = 13,
baseAfterPAM.indelFreq = 24
)
Arguments
inputFilePath |
Sequence input file path or a DNAStringSet object that contains sequences to be searched for potential gRNAs |
format |
Format of the input file, fasta, fastq and bed are supported, default fasta |
header |
Indicate whether the input file contains header, default FALSE, only applies to bed format |
gRNAoutputName |
Specify the name of the gRNA outupt file when inputFilePath is DNAStringSet object instead of file path |
findgRNAs |
Indicate whether to find gRNAs from the sequences in the input file or skip the step of finding gRNAs, default TRUE. Set it to FALSE if the input file contains user selected gRNAs plus PAM already. |
exportAllgRNAs |
Indicate whether to output all potential gRNAs to a file in fasta format, genbank format or both. Default to both. |
findgRNAsWithREcutOnly |
Indicate whether to find gRNAs overlap with restriction enzyme recognition pattern |
REpatternFile |
File path containing restriction enzyme cut patterns |
minREpatternSize |
Minimum restriction enzyme recognition pattern length required for the enzyme pattern to be searched for, default 4 |
overlap.gRNA.positions |
The required overlap positions of gRNA and restriction enzyme cut site, default 17 and 18 |
findPairedgRNAOnly |
Choose whether to only search for paired gRNAs in such an orientation that the first one is on minus strand called reverse gRNA and the second one is on plus strand called forward gRNA. TRUE or FALSE, default FALSE |
annotatePaired |
Indicate whether to output paired information, default TRUE |
paired.orientation |
PAMin orientation means the two adjacent PAMs on the sense and antisense strands face inwards towards each other like N21GG and CCN21 whereas PAMout orientation means they face away from each other like CCN21 and N21GG |
enable.multicore |
Indicate whether enable parallel processing, default FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE |
n.cores.max |
Indicating maximum number of cores to use in multi core mode, i.e., parallel processing, default 6. Please set it to 1 to disable multicore processing for small dataset. |
min.gap |
Minimum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 0 |
max.gap |
Maximum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 20 |
gRNA.name.prefix |
The prefix used when assign name to found gRNAs, default gRNA, short for guided RNA. |
PAM.size |
PAM length, default 3 |
gRNA.size |
The size of the gRNA, default 20 |
PAM |
PAM sequence after the gRNA, default NGG |
BSgenomeName |
BSgenome object. Please refer to available.genomes in BSgenome package. For example,
|
chromToSearch |
Specify the chromosome to search, default to all, meaning search all chromosomes. For example, chrX indicates searching for matching in chromosome X only |
chromToExclude |
Specify the chromosome not to search. If specified as "", meaning to search chromosomes specified by chromToSearch. By default, to exclude haplotype blocks from offtarget search in hg19, i.e., chromToExclude = c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1", "chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6", "chr6_ssto_hap7") |
max.mismatch |
Maximum mismatch allowed in off target search, default 3. Warning: will be considerably slower if set > 3 |
PAM.pattern |
Regular expression of protospacer-adjacent motif (PAM), default NNG$|NGN$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM sequence |
allowed.mismatch.PAM |
Maximum number of mismatches allowed in the PAM sequence for offtarget search, default to 1 for NNG or NGN PAM pattern for offtarget finding. |
gRNA.pattern |
Regular expression or IUPAC Extended Genetic Alphabet to represent gRNA pattern, default is no restriction. To specify that the gRNA must start with GG for example, then set it to ^GG. Please see help(translatePattern) for a list of IUPAC Extended Genetic Alphabet. |
baseEditing |
Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly. |
targetBase |
Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system. |
editingWindow |
Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window. |
editingWindow.offtargets |
Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window to consider for the offtargets search only, default to 4 to 8 (1 means the most distal site from the 3' PAM, the most proximla site from the 5' PAM), which is for the original CBE system. Please change it accordingly if the system you use have a different editing window, or you would like to include offtargets with the target base in a larger editing window. |
primeEditing |
Indicate whether to design gRNAs for prime editing. Default to FALSE. If true, please set PBS.length, RT.template.length, RT.template.pattern, targeted.seq.length.change, bp.after.target.end, target.start, and target.end accordingly |
PBS.length |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to ouput for primer binding site. |
RT.template.length |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases required for RT template, default to 8 to 18. Please increase the length if the edit is large insertion. Only gRNAs with calculated RT.template.length falling into the specified range will be in the output. It is calculated as the following. RT.template.length = target.start – cut.start + (target.end - target.start) + targeted.seq.length.change + bp.after.target.end |
RT.template.pattern |
Applicable only when primeEditing is set to TRUE. It is used to specify the RT template sequence pattern, default to not ending with C according to https://doi.org/10.1038/s41586-019-1711-4 |
corrected.seq |
Applicable only when primeEditing is set to TRUE. It is used to specify the mutated or inserted sequences after successful editing. |
targeted.seq.length.change |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of targeted sequence length change. Please set it to 0 for base changes, positive numbers for insersion, and negative number for deletion. For example, 10 means that the corrected sequence will have 10bp insertion, -10 means that the corrected sequence will have 10bp deletion, and 0 means only bases have been changed and the sequence length remains the same |
bp.after.target.end |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to add after the target change end site as part of RT template. Please refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
target.start |
Applicable only when primeEditing is set to TRUE. It is used to specify the start location in the input sequence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
target.end |
Applicable only when primeEditing is set to TRUE. It is used to specify the end location in the input sequnence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
primeEditingPaired.output |
Applicable only when primeEditing is set to TRUE. It is used to specify the file path to save pegRNA and the second gRNA with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls |
min.score |
minimum score of an off target to included in the final output, default 0 |
topN |
top N off targets to be included in the final output, default 1000 |
topN.OfftargetTotalScore |
top N off target used to calculate the total off target score, default 10 |
annotateExon |
Choose whether or not to indicate whether the off target is inside an exon or not, default TRUE |
txdb |
TxDb object, for creating and using TxDb object, please refer to GenomicFeatures package. For a list of existing TxDb object, please search for annotation package starting with Txdb at http://www.bioconductor.org/packages/release/BiocViews.html#___AnnotationData, such as
|
orgAnn |
organism annotation mapping such as org.Hs.egSYMBOL in org.Hs.eg.db package for human |
ignore.strand |
default to TRUE when annotating to gene |
outputDir |
the directory where the off target analysis and reports will be written to |
fetchSequence |
Fetch flank sequence of off target or not, default TRUE |
upstream |
upstream offset from the off target start, default 200 |
downstream |
downstream offset from the off target end, default 200 |
upstream.search |
upstream offset from the bed input starts to search for gRNAs, default 0 |
downstream.search |
downstream offset from the bed input ends to search for gRNAs, default 0 |
weights |
Applicable only when scoring.method is set to Hsu-Zhang a numeric vector size of gRNA length, default c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583) which is used in Hsu et al., 2013 cited in the reference section |
baseBeforegRNA |
Number of bases before gRNA used for calculating gRNA efficiency, default 4 Please note, for PAM located on the 5 prime, need to specify the number of bases before the PAM sequence plus PAM size. |
baseAfterPAM |
Number of bases after PAM used for calculating gRNA efficiency, default 3 for spCas9 Please note, for PAM located on the 5 prime, need to include the length of the gRNA plus the extended sequence on the 3 prime |
featureWeightMatrixFile |
Feature weight matrix file used for calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used. To use alternative weight matrix file, please input a csv file with first column containing significant features and the second column containing the corresponding weights for the features. Please see Doench et al., 2014 for details. |
useScore |
Default TRUE, display in gray scale with the darkness indicating the gRNA efficacy. The taller bar shows the Cas9 cutting site. If set to False, efficacy will not show. Instead, gRNAs in plus strand will be colored red and gRNAs in negative strand will be colored green. |
useEfficacyFromInputSeq |
Default FALSE. If set to TRUE, summary file will contain gRNA efficacy calculated from input sequences instead of from off-target analysis. Set it to TRUE if the input sequence is from a different species than the one used for off-target analysis. |
outputUniqueREs |
Default TRUE. If set to TRUE, summary file will contain REs unique to the cleavage site within 100 or 200 bases surrounding the gRNA sequence. |
foldgRNAs |
Default FALSE. If set to TRUE, summary file will contain minimum free energy of the secondary structure of gRNA with gRNA backbone from GeneRfold package provided that GeneRfold package has been installed. |
gRNA.backbone |
gRNA backbone constant region sequence. Default to the sequence in Sp gRNA backbone. |
temperature |
temperature in celsius. Default to 37 celsius. |
overwrite |
overwrite the existing files in the output directory or not, default FALSE |
scoring.method |
Indicates which method to use for offtarget cleavage rate estimation, currently two methods are supported, Hsu-Zhang and CFDscore |
subPAM.activity |
Applicable only when scoring.method is set to CFDscore A hash to represent the cleavage rate for each alternative sub PAM sequence relative to preferred PAM sequence |
subPAM.position |
Applicable only when scoring.method is set to CFDscore The start and end positions of the sub PAM. Default to 22 and 23 for spCas9 with 20bp gRNA and NGG as preferred PAM. For Cpf1, it could be c(1,2). |
PAM.location |
PAM location relative to gRNA. For example, default to 3prime for spCas9 PAM. Please set to 5prime for cpf1 PAM since it's PAM is located on the 5 prime end |
rule.set |
Specify a rule set scoring system for calculating gRNA efficacy. Please note that Root_RuleSet2_2016 requires the following python packages with specified verion and python 2.7. 1. scikit-learn 0.16.1 2. pickle 3. pandas 4. numpy 5. scipy |
chrom_acc |
Optional binary variable indicating chromatin accessibility information with 1 indicating accessible and 0 not accessible. |
mismatch.activity.file |
Applicable only when scoring.method is set to CFDscore A comma separated (csv) file containing the cleavage rates for all possible types of single nucleotide mismatche at each position of the gRNA. By default, using the supplemental Table 19 from Doench et al., Nature Biotechnology 2016 |
useBSgenome |
Specify whether BSgenome is avaialbe for searching for gRNA and offtargets, default to FALSE. If set it to TRUE, the results should be the same as when using offtargetAnalysis function. |
genomeSeqFile |
Specify the genome sequence file in fasta format. It is only applicable and required when useBSgenome is set to FALSE. |
predIndelFreq |
Default to FALSE. Set it to TRUE to output the predicted indels and their frequencies. |
predictIndelFreq.onTargetOnly |
Default to TRUE, indicating that indels and their frequencies will be predicted for ontargets only. Usually, researchers are only interested in predicting the editing outcome for the ontargets since any editing in the offtargets are unwanted. Set it to FALSE if you are interested in predicting indels and their frequencies for offtargets. It will take longer time to run if you set it to FALSE. |
method.indelFreq |
Currently only Lindel method has been implemented. Please let us know if you think additional methods should be made available. Lindel is compatible with both Python2.7 and Python3.5 or higher. Please type help(predictRelativeFreqIndels) to get more details. |
baseBeforegRNA.indelFreq |
Default to 13 for Lindel method. |
baseAfterPAM.indelFreq |
Default to 24 for Lindel method. |
Value
Four tab delimited files are generated in the output directory:
OfftargetAnalysis.xls |
- detailed information of off targets |
Summary.xls |
- summary of the gRNAs |
REcutDetails.xls |
- restriction enzyme cut sites of each gRNA |
pairedgRNAs.xls |
- potential paired gRNAs |
Author(s)
Lihua Julie Zhu
References
Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao & Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature Biotechnology 31:827-834
Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038 nbt.3026
Lihua Julie Zhu, Benjamin R. Holmes, Neil Aronin and Michael Brodsky. CRISPRseek: a Bioconductor package to identify target-specific guide RNAs for CRISPR-Cas9 genome-editing systems. Plos One Sept 23rd 2014
Moreno-Mateos, M., Vejnar, C., Beaudoin, J. et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods 12, 982–988 (2015) doi:10.1038/nmeth.3543
Doench JG et al., Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature Biotechnology Jan 18th 2016
Anzalone et al., Search-and-replace genome editing without double-strand breaks or donor DNA. Nature October 2019 https://www.nature.com/articles/s41586-019-1711-4
Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05 September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487
See Also
CRISPRseek
Examples
library(CRISPRseek)
inputFilePath <- system.file("extdata", "inputseqWithoutBSgenome.fa",
package = "CRISPRseek")
########### genomeSeq.fasta contains the genomic sequence in fasta format for gRNA and offtarget search###############
genomeSeqFile <- system.file("extdata", "genomeSeq.fasta",
package = "CRISPRseek")
library(hash)
subPAM.activity <- hash(AA = 0, AC = 0, AG = 0.259259259,
AT = 0, CA = 0, CC = 0, CG = 0.107142857, CT = 0, GA = 0.069444444,
GC = 0.022222222, GG = 1, GT = 0.016129032, TA = 0, TC = 0,
TG = 0.038961039, TT = 0)
featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
package = "CRISPRseek")
results <- offTargetAnalysisWithoutBSgenome(inputFilePath = inputFilePath,
format = "fasta",
useBSgenome = FALSE,
genomeSeqFile = genomeSeqFile,
findgRNAs = TRUE,
exportAllgRNAs = "fasta",
fetchSequence = FALSE,
findgRNAsWithREcutOnly = FALSE,
findPairedgRNAOnly = FALSE,
annotatePaired = FALSE,
max.mismatch = 1,
annotateExon = FALSE,
scoring.method = "CFDscore",
min.score = 0.01,
PAM = "NGG",
PAM.pattern <- "NNN",
rule.set = "CRISPRscan",
featureWeightMatrixFile = featureWeightMatrixFile,
subPAM.activity = subPAM.activity,
outputDir = "gRNAoutput-CRISPRseek-CRISPRscan-CFDscore", overwrite = TRUE)
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.