R/offTargetAnalysisWithoutBSgenome.R
In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems
Defines functions
offTargetAnalysisWithoutBSgenome
Documented in
offTargetAnalysisWithoutBSgenome
#' Design of target-specific guide RNAs for CRISPR-Cas9 system in one function
#' without BSgenome
#'
#' Design of target-specific guide RNAs (gRNAs) for CRISPR-Cas9 system without
#' BSgenome by automatically calling findgRNAs, filtergRNAs, searchHits,
#' buildFeatureVectorForScoring, getOfftargetScore, filterOfftarget,
#' calculating gRNA cleavage efficiency and generate reports.
#'
#' %% ~~ If necessary, more details than the description above ~~
#'
#' @param inputFilePath Sequence input file path or a DNAStringSet object that
#' contains sequences to be searched for potential gRNAs
#' @param format Format of the input file, fasta, fastq and bed are supported,
#' default fasta
#' @param header Indicate whether the input file contains header, default
#' FALSE, only applies to bed format
#' @param gRNAoutputName Specify the name of the gRNA outupt file when
#' inputFilePath is DNAStringSet object instead of file path
#' @param findgRNAs Indicate whether to find gRNAs from the sequences in the
#' input file or skip the step of finding gRNAs, default TRUE. Set it to FALSE
#' if the input file contains user selected gRNAs plus PAM already.
#' @param exportAllgRNAs Indicate whether to output all potential gRNAs to a
#' file in fasta format, genbank format or both. Default to both.
#' @param findgRNAsWithREcutOnly Indicate whether to find gRNAs overlap with
#' restriction enzyme recognition pattern
#' @param REpatternFile File path containing restriction enzyme cut patterns
#' @param minREpatternSize Minimum restriction enzyme recognition pattern
#' length required for the enzyme pattern to be searched for, default 4
#' @param overlap.gRNA.positions The required overlap positions of gRNA and
#' restriction enzyme cut site, default 17 and 18
#' @param findPairedgRNAOnly Choose whether to only search for paired gRNAs in
#' such an orientation that the first one is on minus strand called reverse
#' gRNA and the second one is on plus strand called forward gRNA. TRUE or
#' FALSE, default FALSE
#' @param annotatePaired Indicate whether to output paired information, default
#' TRUE
#' @param paired.orientation PAMin orientation means the two adjacent PAMs on
#' the sense and antisense strands face inwards towards each other like N21GG
#' and CCN21 whereas PAMout orientation means they face away from each other
#' like CCN21 and N21GG
#' @param min.gap Minimum distance between two oppositely oriented gRNAs to be
#' valid paired gRNAs. Default 0
#' @param enable.multicore Indicate whether enable parallel processing, default
#' FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE
#' @param n.cores.max Indicating maximum number of cores to use in multi core
#' mode, i.e., parallel processing, default 6. Please set it to 1 to disable
#' multicore processing for small dataset.
#' @param max.gap Maximum distance between two oppositely oriented gRNAs to be
#' valid paired gRNAs. Default 20
#' @param gRNA.name.prefix The prefix used when assign name to found gRNAs,
#' default gRNA, short for guided RNA.
#' @param PAM.size PAM length, default 3
#' @param gRNA.size The size of the gRNA, default 20
#' @param PAM PAM sequence after the gRNA, default NGG
#' @param BSgenomeName BSgenome object. Please refer to available.genomes in
#' BSgenome package. For example,
#' \itemize{
#' \item{BSgenome.Hsapiens.UCSC.hg19} - for hg19,
#' \item{BSgenome.Mmusculus.UCSC.mm10} - for mm10
#' \item{BSgenome.Celegans.UCSC.ce6} - for ce6
#' \item{BSgenome.Rnorvegicus.UCSC.rn5} - for rn5
#' \item{BSgenome.Drerio.UCSC.danRer7} - for Zv9
#' \item{BSgenome.Dmelanogaster.UCSC.dm3} - for dm3
#' }
#' @param chromToSearch Specify the chromosome to search, default to all,
#' meaning search all chromosomes. For example, chrX indicates searching for
#' matching in chromosome X only
#' @param chromToExclude Specify the chromosome not to search. If specified as
#' "", meaning to search chromosomes specified by chromToSearch. By default, to
#' exclude haplotype blocks from offtarget search in hg19, i.e., chromToExclude
#' = c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1", "chr6_cox_hap2",
#' "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6",
#' "chr6_ssto_hap7")
#' @param max.mismatch Maximum mismatch allowed in off target search, default
#' 3. Warning: will be considerably slower if set > 3
#' @param PAM.pattern Regular expression of protospacer-adjacent motif (PAM),
#' default NNG$|NGN$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM
#' sequence
#' @param allowed.mismatch.PAM Maximum number of mismatches allowed in the PAM
#' sequence for offtarget search, default to 1 for NNG or NGN PAM pattern for
#' offtarget finding.
#' @param gRNA.pattern Regular expression or IUPAC Extended Genetic Alphabet to
#' represent gRNA pattern, default is no restriction. To specify that the gRNA
#' must start with GG for example, then set it to ^GG. Please see
#' help(translatePattern) for a list of IUPAC Extended Genetic Alphabet.
#' @param baseEditing Indicate whether to design gRNAs for base editing.
#' Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and
#' editingWidow accordingly.
#' @param targetBase Applicable only when baseEditing is set to TRUE. It is
#' used to indicate the target base for base editing systems, default to C for
#' converting C to T in the CBE system. Please change it to A if you intend to
#' use the ABE system.
#' @param editingWindow Applicable only when baseEditing is set to TRUE. It is
#' used to indicate the effective editing window, default to 4 to 8 which is
#' for the original CBE system. Please change it accordingly if the system you
#' use have a different editing window.
#' @param editingWindow.offtargets Applicable only when baseEditing is set to
#' TRUE. It is used to indicate the effective editing window to consider for
#' the offtargets search only, default to 4 to 8 (1 means the most distal site
#' from the 3' PAM, the most proximla site from the 5' PAM), which is for the
#' original CBE system. Please change it accordingly if the system you use
#' have a different editing window, or you would like to include offtargets
#' with the target base in a larger editing window.
#' @param primeEditing Indicate whether to design gRNAs for prime editing.
#' Default to FALSE. If true, please set PBS.length, RT.template.length,
#' RT.template.pattern, targeted.seq.length.change, bp.after.target.end,
#' target.start, and target.end accordingly
#' @param PBS.length Applicable only when primeEditing is set to TRUE. It is
#' used to specify the number of bases to ouput for primer binding site.
#' @param RT.template.length Applicable only when primeEditing is set to TRUE.
#' It is used to specify the number of bases required for RT template, default
#' to 8 to 18. Please increase the length if the edit is large insertion. Only
#' gRNAs with calculated RT.template.length falling into the specified range
#' will be in the output. It is calculated as the following. RT.template.length
#' = target.start – cut.start + (target.end - target.start) +
#' targeted.seq.length.change + bp.after.target.end
#' @param RT.template.pattern Applicable only when primeEditing is set to TRUE.
#' It is used to specify the RT template sequence pattern, default to not
#' ending with C according to https://doi.org/10.1038/s41586-019-1711-4
#' @param corrected.seq Applicable only when primeEditing is set to TRUE. It is
#' used to specify the mutated or inserted sequences after successful editing.
#' @param targeted.seq.length.change Applicable only when primeEditing is set
#' to TRUE. It is used to specify the number of targeted sequence length
#' change. Please set it to 0 for base changes, positive numbers for insersion,
#' and negative number for deletion. For example, 10 means that the corrected
#' sequence will have 10bp insertion, -10 means that the corrected sequence
#' will have 10bp deletion, and 0 means only bases have been changed and the
#' sequence length remains the same
#' @param bp.after.target.end Applicable only when primeEditing is set to TRUE.
#' It is used to specify the number of bases to add after the target change end
#' site as part of RT template. Please refer to RT.template.length for how this
#' parameter influences the RT.template.length calculation which is used as a
#' filtering criteria in pregRNA selection.
#' @param target.start Applicable only when primeEditing is set to TRUE. It is
#' used to specify the start location in the input sequence to make changes,
#' which will be used to obtain the RT template sequence. Please also refer to
#' RT.template.length for how this parameter influences the RT.template.length
#' calculation which is used as a filtering criteria in pregRNA selection.
#' @param target.end Applicable only when primeEditing is set to TRUE. It is
#' used to specify the end location in the input sequnence to make changes,
#' which will be used to obtain the RT template sequence. Please also refer to
#' RT.template.length for how this parameter influences the RT.template.length
#' calculation which is used as a filtering criteria in pregRNA selection.
#' @param primeEditingPaired.output Applicable only when primeEditing is set to
#' TRUE. It is used to specify the file path to save pegRNA and the second gRNA
#' with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls
#' @param min.score minimum score of an off target to included in the final
#' output, default 0
#' @param topN top N off targets to be included in the final output, default
#' 1000
#' @param topN.OfftargetTotalScore top N off target used to calculate the total
#' off target score, default 10
#' @param annotateExon Choose whether or not to indicate whether the off target
#' is inside an exon or not, default TRUE
#' @param txdb TxDb object, for creating and using TxDb object, please refer to
#' GenomicFeatures package. For a list of existing TxDb object, please search
#' for annotation package starting with Txdb at
#' http://www.bioconductor.org/packages/release/BiocViews.html#___AnnotationData,
#' such as
#' \itemize{
#' \item{TxDb.Rnorvegicus.UCSC.rn5.refGene} - {for rat}
#' \item{TxDb.Mmusculus.UCSC.mm10.knownGene} - {for mouse}
#' \item{TxDb.Hsapiens.UCSC.hg19.knownGene} - {for human}
#' \item{TxDb.Dmelanogaster.UCSC.dm3.ensGene} - {for Drosophila}
#' \item{TxDb.Celegans.UCSC.ce6.ensGene} - {for C.elegans}
#' }
#' @param orgAnn organism annotation mapping such as org.Hs.egSYMBOL in
#' org.Hs.eg.db package for human
#' @param ignore.strand default to TRUE when annotating to gene
#' @param outputDir the directory where the off target analysis and reports
#' will be written to
#' @param fetchSequence Fetch flank sequence of off target or not, default TRUE
#' @param upstream upstream offset from the off target start, default 200
#' @param downstream downstream offset from the off target end, default 200
#' @param upstream.search upstream offset from the bed input starts to search
#' for gRNAs, default 0
#' @param downstream.search downstream offset from the bed input ends to search
#' for gRNAs, default 0
#' @param weights Applicable only when scoring.method is set to Hsu-Zhang a
#' numeric vector size of gRNA length, default c(0, 0, 0.014, 0, 0, 0.395,
#' 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615,
#' 0.804, 0.685, 0.583) which is used in Hsu et al., 2013 cited in the
#' reference section
#' @param baseBeforegRNA Number of bases before gRNA used for calculating gRNA
#' efficiency, default 4 Please note, for PAM located on the 5 prime, need to
#' specify the number of bases before the PAM sequence plus PAM size.
#' @param baseAfterPAM Number of bases after PAM used for calculating gRNA
#' efficiency, default 3 for spCas9 Please note, for PAM located on the 5
#' prime, need to include the length of the gRNA plus the extended sequence on
#' the 3 prime
#' @param featureWeightMatrixFile Feature weight matrix file used for
#' calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used.
#' To use alternative weight matrix file, please input a csv file with first
#' column containing significant features and the second column containing the
#' corresponding weights for the features. Please see Doench et al., 2014 for
#' details.
#' @param useScore Default TRUE, display in gray scale with the darkness
#' indicating the gRNA efficacy. The taller bar shows the Cas9 cutting site.
#' If set to False, efficacy will not show. Instead, gRNAs in plus strand will
#' be colored red and gRNAs in negative strand will be colored green.
#' @param useEfficacyFromInputSeq Default FALSE. If set to TRUE, summary file
#' will contain gRNA efficacy calculated from input sequences instead of from
#' off-target analysis. Set it to TRUE if the input sequence is from a
#' different species than the one used for off-target analysis.
#' @param outputUniqueREs Default TRUE. If set to TRUE, summary file will
#' contain REs unique to the cleavage site within 100 or 200 bases surrounding
#' the gRNA sequence.
#' @param foldgRNAs Default FALSE. If set to TRUE, summary file will contain
#' minimum free energy of the secondary structure of gRNA with gRNA backbone
#' from GeneRfold package provided that GeneRfold package has been installed.
#' @param gRNA.backbone gRNA backbone constant region sequence. Default to the
#' sequence in Sp gRNA backbone.
#' @param temperature temperature in celsius. Default to 37 celsius.
#' @param overwrite overwrite the existing files in the output directory or
#' not, default FALSE
#' @param scoring.method Indicates which method to use for offtarget cleavage
#' rate estimation, currently two methods are supported, Hsu-Zhang and CFDscore
#' @param subPAM.activity Applicable only when scoring.method is set to
#' CFDscore A hash to represent the cleavage rate for each alternative sub PAM
#' sequence relative to preferred PAM sequence
#' @param subPAM.position Applicable only when scoring.method is set to
#' CFDscore The start and end positions of the sub PAM. Default to 22 and 23
#' for spCas9 with 20bp gRNA and NGG as preferred PAM. For Cpf1, it could be
#' c(1,2).
#' @param PAM.location PAM location relative to gRNA. For example, default to
#' 3prime for spCas9 PAM. Please set to 5prime for cpf1 PAM since it's PAM is
#' located on the 5 prime end
#' @param rule.set Specify a rule set scoring system for calculating gRNA
#' efficacy. Please note that Root_RuleSet2_2016 requires the following python
#' packages with specified verion and python 2.7. 1. scikit-learn 0.16.1 2.
#' pickle 3. pandas 4. numpy 5. scipy
#' @param chrom_acc Optional binary variable indicating chromatin accessibility
#' information with 1 indicating accessible and 0 not accessible.
#' @param mismatch.activity.file Applicable only when scoring.method is set to
#' CFDscore A comma separated (csv) file containing the cleavage rates for all
#' possible types of single nucleotide mismatche at each position of the gRNA.
#' By default, using the supplemental Table 19 from Doench et al., Nature
#' Biotechnology 2016
#' @param useBSgenome Specify whether BSgenome is avaialbe for searching for
#' gRNA and offtargets, default to FALSE. If set it to TRUE, the results should
#' be the same as when using offtargetAnalysis function.
#' @param genomeSeqFile Specify the genome sequence file in fasta format. It is
#' only applicable and required when useBSgenome is set to FALSE.
#' @param predIndelFreq Default to FALSE. Set it to TRUE to output the
#' predicted indels and their frequencies.
#' @param predictIndelFreq.onTargetOnly Default to TRUE, indicating that indels
#' and their frequencies will be predicted for ontargets only. Usually,
#' researchers are only interested in predicting the editing outcome for the
#' ontargets since any editing in the offtargets are unwanted. Set it to FALSE
#' if you are interested in predicting indels and their frequencies for
#' offtargets. It will take longer time to run if you set it to FALSE.
#' @param method.indelFreq Currently only Lindel method has been implemented.
#' Please let us know if you think additional methods should be made available.
#' Lindel is compatible with both Python2.7 and Python3.5 or higher. Please
#' type help(predictRelativeFreqIndels) to get more details.
#' @param baseBeforegRNA.indelFreq Default to 13 for Lindel method.
#' @param baseAfterPAM.indelFreq Default to 24 for Lindel method.
#' @return Four tab delimited files are generated in the output directory:
#' \item{OfftargetAnalysis.xls}{ - detailed information of off targets}
#' \item{Summary.xls}{ - summary of the gRNAs}
#' \item{REcutDetails.xls}{ - restriction enzyme cut sites of each gRNA}
#' \item{pairedgRNAs.xls}{ - potential paired gRNAs}
#' @note %% ~~further notes~~
#' @author Lihua Julie Zhu
#' @seealso CRISPRseek
#' @references Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran,
#' Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
#' Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao & Feng Zhang
#' (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
#' Biotechnology 31:827-834
#'
#' Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M,
#' Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for
#' CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi:
#' 10.1038 nbt.3026
#'
#' Lihua Julie Zhu, Benjamin R. Holmes, Neil Aronin and Michael Brodsky.
#' CRISPRseek: a Bioconductor package to identify target-specific guide RNAs
#' for CRISPR-Cas9 genome-editing systems. Plos One Sept 23rd 2014
#'
#' Moreno-Mateos, M., Vejnar, C., Beaudoin, J. et al. CRISPRscan: designing
#' highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods 12,
#' 982–988 (2015) doi:10.1038/nmeth.3543
#'
#' Doench JG et al., Optimized sgRNA design to maximize activity and minimize
#' off-target effects of CRISPR-Cas9. Nature Biotechnology Jan 18th 2016
#'
#' Anzalone et al., Search-and-replace genome editing without double-strand
#' breaks or donor DNA. Nature October 2019
#' https://www.nature.com/articles/s41586-019-1711-4
#'
#' Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel
#' profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated
#' double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05
#' September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487
#' @keywords misc
#' @examples
#'
#' library(CRISPRseek)
#' inputFilePath <- system.file("extdata", "inputseqWithoutBSgenome.fa",
#' package = "CRISPRseek")
#' ########### genomeSeq.fasta contains the genomic sequence in fasta format for gRNA and offtarget search###############
#' genomeSeqFile <- system.file("extdata", "genomeSeq.fasta",
#' package = "CRISPRseek")
#' library(hash)
#' subPAM.activity <- hash(AA = 0, AC = 0, AG = 0.259259259,
#' AT = 0, CA = 0, CC = 0, CG = 0.107142857, CT = 0, GA = 0.069444444,
#' GC = 0.022222222, GG = 1, GT = 0.016129032, TA = 0, TC = 0,
#' TG = 0.038961039, TT = 0)
#' featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
#' package = "CRISPRseek")
#' results <- offTargetAnalysisWithoutBSgenome(inputFilePath = inputFilePath,
#' format = "fasta",
#' useBSgenome = FALSE,
#' genomeSeqFile = genomeSeqFile,
#' findgRNAs = TRUE,
#' exportAllgRNAs = "fasta",
#' fetchSequence = FALSE,
#' findgRNAsWithREcutOnly = FALSE,
#' findPairedgRNAOnly = FALSE,
#' annotatePaired = FALSE,
#' max.mismatch = 1,
#' annotateExon = FALSE,
#' scoring.method = "CFDscore",
#' min.score = 0.01,
#' PAM = "NGG",
#' PAM.pattern <- "NNN",
#' rule.set = "CRISPRscan",
#' featureWeightMatrixFile = featureWeightMatrixFile,
#' subPAM.activity = subPAM.activity,
#' outputDir = "gRNAoutput-CRISPRseek-CRISPRscan-CFDscore", overwrite = TRUE)
#' @importFrom hash hash
#' @importFrom utils read.csv write.table read.table
#' @importFrom GenomicRanges intersect setdiff
#' @importFrom Biostrings writeXStringSet readDNAStringSet
#' @importFrom BiocGenerics rbind cbind unlist lapply
#' @export
offTargetAnalysisWithoutBSgenome <-
function(inputFilePath, format = "fasta", header=FALSE,
gRNAoutputName, findgRNAs = TRUE,
exportAllgRNAs = c("all", "fasta", "genbank", "no"),
findgRNAsWithREcutOnly = FALSE,
REpatternFile = system.file("extdata", "NEBenzymes.fa",
package = "CRISPRseek"),
minREpatternSize = 4,
overlap.gRNA.positions = c(17, 18), findPairedgRNAOnly = FALSE,
annotatePaired = TRUE, paired.orientation = c("PAMout","PAMin"),
enable.multicore = FALSE, n.cores.max = 6,
min.gap = 0, max.gap = 20, gRNA.name.prefix = "",
PAM.size = 3, gRNA.size = 20, PAM = "NGG", BSgenomeName,
chromToSearch = "all",
chromToExclude = c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1",
"chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6",
"chr6_ssto_hap7"),
max.mismatch = 3,
PAM.pattern = "NNG$|NGN$", allowed.mismatch.PAM = 1,
gRNA.pattern = "",
baseEditing = FALSE, targetBase = "C", editingWindow = 4:8,
editingWindow.offtargets = 4:8,
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.score = 0, topN = 1000,
topN.OfftargetTotalScore = 10,
annotateExon = TRUE, txdb, orgAnn, ignore.strand = TRUE, outputDir,
fetchSequence = TRUE, upstream = 200, downstream = 200,
upstream.search = 0, downstream.search = 0,
weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445,
0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583),
baseBeforegRNA = 4, baseAfterPAM = 3,
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv",
package = "CRISPRseek"),
useScore = TRUE, useEfficacyFromInputSeq = FALSE,
outputUniqueREs = TRUE, foldgRNAs = FALSE,
gRNA.backbone="GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU",
temperature = 37,
overwrite = FALSE,
scoring.method = c("Hsu-Zhang", "CFDscore"),
subPAM.activity = hash( AA =0,
AC = 0,
AG = 0.259259259,
AT = 0,
CA = 0,
CC = 0,
CG = 0.107142857,
CT = 0,
GA = 0.069444444,
GC = 0.022222222,
GG = 1,
GT = 0.016129032,
TA = 0,
TC = 0,
TG = 0.038961039,
TT = 0),
subPAM.position = c(22, 23),
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc,
mismatch.activity.file = system.file("extdata",
"NatureBiot2016SuppTable19DoenchRoot.csv",
package = "CRISPRseek"),
useBSgenome = FALSE, genomeSeqFile,
predIndelFreq = FALSE,
predictIndelFreq.onTargetOnly = TRUE,
method.indelFreq = "Lindel",
baseBeforegRNA.indelFreq = 13,
baseAfterPAM.indelFreq = 24
)
{
cat("Validating input ...\n")
scoring.method <- match.arg(scoring.method)
exportAllgRNAs <- match.arg(exportAllgRNAs)
rule.set <- match.arg(rule.set)
exportAllgRNAs <- match.arg(exportAllgRNAs)
paired.orientation <- match.arg(paired.orientation)
PAM.p.letters <- strsplit(PAM.pattern, split="")[[1]]
if (PAM.location == "3prime" && PAM.p.letters[length(PAM.p.letters)] != "$")
PAM.pattern <- paste0(PAM.pattern, "$")
if (PAM.location == "5prime" && PAM.p.letters[1] != "^")
PAM.pattern <- paste0("^", PAM.pattern)
if (rule.set == "DeepCpf1")
{
baseBeforegRNA <- 8
baseAfterPAM <- 26
if (scoring.method == "CFDscore" && subPAM.activity$TT < 1)
subPAM.activity = hash( AA =0,
AC = 0,
AG = 0,
AT = 0.1,
CA = 0,
CC = 0,
CG = 0,
CT = 0.05,
GA = 0,
GC = 0,
GG = 0,
GT = 0.05,
TA = 0.2,
TC = 0.1,
TG = 0.1,
TT = 1)
}
else if (rule.set %in% c("Root_RuleSet1_2014",
"Root_RuleSet2_2016", "CRISPRscan"))
{
if (PAM.location == "3prime")
{
baseBeforegRNA <- 4
baseAfterPAM <- 3
}
else
{
baseBeforegRNA <- 4 + PAM.size
baseAfterPAM <- 3 + gRNA.size
}
}
if (scoring.method == "CFDscore")
{
mismatch.activity <- read.csv(mismatch.activity.file)
required.col <- c("Mismatch.Type", "Position", "Percent.Active")
if (length(intersect(colnames(mismatch.activity), required.col)) !=
length(required.col))
stop("Please rename the mismatch activity file column to contain at least
these 3 column names: Mismatch.Type, Position, Percent.Active\n")
}
else if (scoring.method == "Hsu-Zhang")
{
if (length(weights) != gRNA.size)
stop("Please make sure the size of weights vector
equals to the gRNA.size!\n")
}
if(findgRNAsWithREcutOnly && findgRNAs && !file.exists(REpatternFile))
{
stop("Please specify an REpattern file as fasta file with
restriction enzyme recognition sequences!")
}
if (missing(inputFilePath)) {
stop("inputFilePath containing the searching sequence, coordinate or a DNAStringSet
object is required!")
}
if (substr(outputDir, nchar(outputDir), nchar(outputDir)) != .Platform$file.sep)
{
outputDir <- paste(outputDir, "", sep = .Platform$file.sep)
}
if (file.exists(outputDir) && ! overwrite)
{
cat(outputDir, "exists already. Please type 1 if you want to
overwrite the outputDir and 2 if you want to exit.", fill = TRUE)
input <- readline()
if(input != 1) { stop("Please change the outputDir!") }
}
if (!file.exists(outputDir))
{
dir.create(outputDir)
}
if (annotatePaired || findPairedgRNAOnly)
pairOutputFile <- paste(outputDir, "pairedgRNAs.xls", sep = "")
REcutDetailFile <- paste(outputDir, "REcutDetails.xls", sep = "")
bedFile<- paste(outputDir, "gRNAsCRISPRseek.bed", sep = "")
if (missing(gRNAoutputName) && class(inputFilePath) == "DNAStringSet")
stop("Please enter a name for the gRNA ouput file name when DNAStringSet instead of file path provided!")
if (class(inputFilePath) != "DNAStringSet" && missing(gRNAoutputName))
gRNAoutputName = strsplit(basename(inputFilePath), split=".",
fixed=TRUE)[[1]][1]
if (format =="bed")
{
if (missing(BSgenomeName) || class(BSgenomeName) != "BSgenome") {
stop("BSgenomeName is required as BSgenome object when input file is in bed format!")
}
inputFilePath <- getSeqFromBed(inputFilePath, header = header, BSgenomeName = BSgenomeName)
#### format for filtergRNAs
format <- "fasta"
}
if (findgRNAs)
{
cat("Searching for gRNAs ...\n")
efficacyFile <- paste(outputDir, "gRNAefficacy.xls", sep = "")
if ((length(chromToSearch) == 1 && chromToSearch == "") || useEfficacyFromInputSeq)
potential.gRNAs <- findgRNAs(inputFilePath,
overlap.gRNA.positions = overlap.gRNA.positions,
baseEditing = baseEditing, targetBase = targetBase, editingWindow = editingWindow,
primeEditing = primeEditing,
findPairedgRNAOnly = findPairedgRNAOnly,
annotatePaired = annotatePaired,
paired.orientation = paired.orientation,
pairOutputFile = pairOutputFile, PAM = PAM,
PAM.location = PAM.location,
gRNA.pattern = gRNA.pattern, PAM.size = PAM.size,
gRNA.size = gRNA.size, min.gap = min.gap,
max.gap = max.gap, name.prefix = gRNA.name.prefix,
format = format, featureWeightMatrixFile = featureWeightMatrixFile,
baseBeforegRNA = baseBeforegRNA,
baseAfterPAM = baseAfterPAM ,
calculategRNAEfficacy = TRUE, efficacyFile = efficacyFile,
rule.set = rule.set, chrom_acc = chrom_acc)
else
potential.gRNAs <- findgRNAs(inputFilePath,
overlap.gRNA.positions = overlap.gRNA.positions,
baseEditing = baseEditing, targetBase = targetBase, editingWindow = editingWindow,
primeEditing = primeEditing,
PBS.length = PBS.length,
RT.template.length = RT.template.length,
RT.template.pattern = RT.template.pattern,
corrected.seq = corrected.seq,
targeted.seq.length.change = targeted.seq.length.change,
bp.after.target.end = bp.after.target.end,
target.start = target.start,
target.end = target.end,
primeEditingPaired.output = primeEditingPaired.output,
findPairedgRNAOnly = findPairedgRNAOnly,
annotatePaired = annotatePaired,
paired.orientation = paired.orientation,
enable.multicore = enable.multicore,
n.cores.max = n.cores.max,
pairOutputFile = pairOutputFile, PAM = PAM,
gRNA.pattern = gRNA.pattern, PAM.size = PAM.size,
PAM.location = PAM.location,
gRNA.size = gRNA.size, min.gap = min.gap,
max.gap = max.gap, name.prefix = gRNA.name.prefix,
format = format, rule.set = rule.set, chrom_acc = chrom_acc)
if (length(potential.gRNAs) == 0)
{
return(cat("no gRNAs found!"))
}
if (length(potential.gRNAs) > 0 && (exportAllgRNAs == "fasta" || exportAllgRNAs == "all"))
{
writeXStringSet(potential.gRNAs, filepath= file.path(outputDir,
paste(gRNAoutputName,"allgRNAs.fa", sep="")))
}
if (length(potential.gRNAs) > 0 && (exportAllgRNAs == "genbank" || exportAllgRNAs == "all"))
{
if (class(inputFilePath) == "DNAStringSet")
subjects <- inputFilePath
else
subjects <- readDNAStringSet(inputFilePath, format=format,
use.names = TRUE)
names(subjects) <- gsub( "\t", "", names(subjects))
names(subjects) <- gsub( "\n", "", names(subjects))
names(subjects) <- gsub( " ", "", names(subjects))
locuses <- names(subjects)
names.gRNA <- names(potential.gRNAs)
for (i in 1:length(locuses))
{
thisLocus <- gsub("'", "", locuses[i])
thisLocus <- gsub(" ", "", thisLocus)
thisSeq <- tolower(as.character(subjects[[i]]))
n.bp <- nchar(thisSeq)
temp <- strsplit(names.gRNA, split=paste(
thisLocus,"_gR",sep=""))
locus <- paste("LOCUS ", thisLocus,
" ", n.bp,
" bp dna linear UNK", sep="")
definition <- paste("DEFINITION CRISPRseek output for ",
gRNAoutputName, " sequence", sep = "")
accession <- "ACCESSION unknown"
features <- "FEATURES Location/Qualifiers"
header = rbind(locus, definition, accession, features)
found.gRNA <- 0
for (j in 1:length(temp))
{
if (length(temp[[j]]) >1){
found.gRNA <- found.gRNA + 1
if (found.gRNA == 1)
{
thisFile <- file.path(outputDir,
paste(thisLocus, "gbk", sep="."))
write(header, thisFile)
}
if (length(grep("f", temp[[j]])) >0)
{
temp1 <-strsplit(temp[[j]], "f")
isForward <- TRUE
}
else
{
temp1 <-strsplit(temp[[j]], "r")
isForward <- FALSE
}
feature <- temp1[[2]][2]
feature[is.na(feature)] <- ""
location <- temp1[[2]][1]
if (isForward)
{
Start <- location
End <- as.numeric(Start) + max(overlap.gRNA.positions) -
min(overlap.gRNA.positions)
write(paste(" misc_bind ", Start, "..",
End, sep = ""), append = TRUE, sep="\n",
file = thisFile)
write(paste(" /note=\"gRNAf",
as.character(feature),
"\"", sep = ""), append = TRUE, sep="\n", file = thisFile)
}
else
{
End <- location
Start <- as.numeric(End) - max(overlap.gRNA.positions) +
min(overlap.gRNA.positions)
write(paste(" misc_bind complement(",
Start, "..", End, ")", sep = ""),
append = TRUE, sep="\n", file = thisFile)
write(paste(" /note=\"gRNAr",
feature,
"\"", sep = ""), append = TRUE, sep="\n", file = thisFile)
}
}
}
if (found.gRNA > 0){
write("ORIGIN", append = TRUE, sep="\n", file = thisFile)
seq.lines <- floor(nchar(thisSeq) / 60) + 1
for (k in 1:seq.lines) {
line.start <- (k - 1) * 60 + 1
line.end <- min(line.start + 59, nchar(thisSeq))
n.leading.spaces <- 9 - nchar(line.start)
leading.spaces <- paste(rep(" ", n.leading.spaces),
collapse = "")
seq.thisLine <- substr(thisSeq, line.start, line.end)
len.thisLine <- nchar(seq.thisLine)
n.seg <- floor(len.thisLine /10) + 1
for (l in 1:n.seg) {
seg.start <- (l -1) * 10 + 1
seg.end <- min(seg.start + 9, len.thisLine)
if (l == 1)
seq.thisLine.formatted <- substr(seq.thisLine,
seg.start, seg.end)
else
seq.thisLine.formatted <- paste(
seq.thisLine.formatted,
substr(seq.thisLine, seg.start, seg.end),
sep = " ")
}
write(paste(leading.spaces, line.start, " ",
seq.thisLine.formatted, sep = ""),
append = TRUE, sep="\n", file = thisFile)
}
write("//", append = TRUE, sep="\n", file = thisFile)
}
}
}
if (findPairedgRNAOnly && length(potential.gRNAs) >0)
{
gRNAs.RE <- filtergRNAs(potential.gRNAs,
pairOutputFile = pairOutputFile,
findgRNAsWithREcutOnly = findgRNAsWithREcutOnly,
REpatternFile = REpatternFile,
format = format, minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(REcutDetails[order(as.character(
REcutDetails$ForwardgRNAName)), ], file = REcutDetailFile,
sep = "\t", row.names = FALSE)
}
else if (length(potential.gRNAs) >0)
{
gRNAs.RE <- filtergRNAs(potential.gRNAs,
findgRNAsWithREcutOnly = findgRNAsWithREcutOnly,
REpatternFile = REpatternFile, format = format,
minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(REcutDetails[order(as.character(
REcutDetails$REcutgRNAName)), ], file = REcutDetailFile,
sep = "\t", row.names = FALSE)
}
if (findgRNAsWithREcutOnly)
{
gRNAs <- gRNAs.RE$gRNAs
}
else
{
gRNAs <- potential.gRNAs
}
if ( annotatePaired || findPairedgRNAOnly)
pairedInformation <- read.table(pairOutputFile, sep = "\t",
header = TRUE, stringsAsFactors = FALSE)
}
else
{
if (class(inputFilePath) != "DNAStringSet")
{
if (! file.exists(inputFilePath)) {
stop("inputfile specified as ", inputFilePath, " does not exists!")
}
if (format == "fasta" || format == "fastq")
{
potential.gRNAs <- readDNAStringSet(inputFilePath, format,
use.names = TRUE)
}
else
{
stop("format needs to be either fasta,fastq or bed!")
}
}
else
{
potential.gRNAs <- inputFilePath
if (length(names(potential.gRNAs)) == 0)
names(potential.gRNAs) <- paste("gRNAs", 1:length(potential.gRNAs), sep="")
}
gRNAs.RE <- filtergRNAs(potential.gRNAs,
REpatternFile = REpatternFile, format = format,
minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(
REcutDetails[order(as.character(REcutDetails$REcutgRNAName)), ],
file = REcutDetailFile, sep = "\t", row.names = FALSE)
if (findgRNAsWithREcutOnly)
{
gRNAs <- gRNAs.RE$gRNAs
}
else
{
gRNAs <- potential.gRNAs
}
pairedInformation <- ""
}
if (length(chromToSearch) == 1 && chromToSearch == "")
{
cat("Done. Please check output files in directory ", outputDir, "\n")
return(gRNAs)
}
if (useBSgenome && (missing(BSgenomeName) || class(BSgenomeName) != "BSgenome")) {
stop("BSgenomeName is required as BSgenome object when useBSgenome is set to true for offtarget search!")
}
if (!useBSgenome && missing(genomeSeqFile))
stop("To perform offtarget search with useBSgenome set to FALSE, genomeSeqFile needs to be set to a genome sequence file in fasta format!\n")
if (annotateExon && (missing(txdb) || (class(txdb) != "TxDb" &&
class(txdb) != "TranscriptDb")))
{
stop("To indicate whether an offtarget is inside an exon, txdb is
required as TxDb object!")
}
names(gRNAs) <- gsub( "\t", "", names(gRNAs))
names(gRNAs) <- gsub( "\n", "", names(gRNAs))
names(gRNAs) <- gsub( " ", "", names(gRNAs))
if (useBSgenome) {
hits <- searchHits2(gRNAs = gRNAs, PAM = PAM, PAM.pattern = PAM.pattern,
BSgenomeName = BSgenomeName, chromToSearch = chromToSearch,
chromToExclude = chromToExclude,
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size, allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets)
}
else {
genomeSeq <- readDNAStringSet(genomeSeqFile)
if (length(chromToSearch) == 1 && tolower(chromToSearch) == "all")
chromInd <- 1:length(genomeSeq)
else
chromInd <- which(names(genomeSeq) %in% chromToSearch)
chromInd <- setdiff(chromInd, which(names(genomeSeq) %in% chromToExclude))
outfile <- tempfile(tmpdir = getwd())
for (j in chromInd) {
if (j == chromInd[1])
hits <- searchHits(gRNAs = gRNAs,
seqs = genomeSeq[[j]],
seqname = names(genomeSeq)[j],
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size,
allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets,
outfile = outfile)
else
hits <- rbind(hits, searchHits(gRNAs = gRNAs,
PAM = PAM, PAM.pattern = PAM.pattern,
seqs = genomeSeq[[j]],
seqname = names(genomeSeq)[j],
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size,
allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets,
outfile = outfile))
}
}
if (dim(hits)[1] > 0)
{
cat("Building feature vectors for scoring ...\n")
#save(hits, file = "hits.RData")
featureVectors <- buildFeatureVectorForScoring(hits = hits,
canonical.PAM = PAM, gRNA.size = gRNA.size,
subPAM.position = subPAM.position,
PAM.location = PAM.location, PAM.size = PAM.size)
cat("Calculating scores ...\n")
if ( scoring.method == "CFDscore")
scores <- getOfftargetScore2(featureVectors,
subPAM.activity = subPAM.activity,
mismatch.activity.file = mismatch.activity.file)
else
scores <- getOfftargetScore(featureVectors, weights = weights)
#write.table(scores, file="testScore2.xls", sep="\t", row.names=FALSE)
cat("Annotating, filtering and generating reports ...\n")
#saveRDS(scores, file="scores.RDS")
offTargets <- filterOffTargetWithoutBSgenome(scores = scores, outputDir = outputDir,
BSgenomeName = BSgenomeName, fetchSequence = fetchSequence, txdb = txdb,
orgAnn = orgAnn, ignore.strand = ignore.strand,
min.score = min.score, topN = topN,
topN.OfftargetTotalScore = topN.OfftargetTotalScore,
upstream = upstream, downstream = downstream,
annotateExon = annotateExon, baseBeforegRNA = baseBeforegRNA,
baseAfterPAM = baseAfterPAM,
gRNA.size = gRNA.size,
PAM.location = PAM.location, PAM.size = PAM.size,
featureWeightMatrixFile = featureWeightMatrixFile,
rule.set = rule.set, chrom_acc = chrom_acc,
useBSgenome = useBSgenome, genomeSeq = genomeSeq)
# saveRDS(offTargets, file = "offTargets.RDS")
cat("Done annotating\n")
summary <- read.table(paste(outputDir, "Summary.xls", sep = ""), sep = "\t",
header = TRUE, stringsAsFactors = FALSE)
if (dim(summary)[2] == 1)
summary <- as.data.frame(t(data.matrix(offTargets$summary)))
for (i in grep("topOfftarget", names(summary)))
{
y <- as.character(summary[,i])
y[is.na(y)] <- ""
summary[, i] = y
}
if (findgRNAs && (annotatePaired || findPairedgRNAOnly))
{
cat("Add paired information...\n")
PairedgRNAName <- unlist(lapply(1:dim(summary)[1], function(i) {
as.character(gsub("^\\s+|\\s+$", "",
paste(unique(pairedInformation[as.character(
pairedInformation$ForwardgRNAName) == as.character(
summary$names[i]),]$ReversegRNAName),
unique(pairedInformation[as.character(
pairedInformation$ReversegRNAName) == as.character(
summary$names[i]),]$ForwardgRNAName),
collapse = " ")))
}))
}
cat("Add RE information...\n")
if (findPairedgRNAOnly && findgRNAs)
{
REname <- unlist(lapply(1:dim(summary)[1], function(i) {
gsub("^\\s+|\\s+$", "", gsub("NA", "",
paste(unique(REcutDetails[as.character(
REcutDetails$ForwardREcutgRNAName) == as.character(
summary$names[i]),]$ForwardREname),
unique(REcutDetails[as.character(
REcutDetails$ReverseREcutgRNAName) ==
as.character(summary$names[i]), ]$ReverseREname),
collapse = " ")))
}))
summary <- cbind(summary, PairedgRNAName, REname)
}
else
{
REname <- unlist(lapply(1:dim(summary)[1], function(i) {
gsub("^\\s+|\\s+$", "", gsub("NA", "", paste(unique(
REcutDetails[as.character(REcutDetails$REcutgRNAName) ==
as.character(summary$names[i]), ]$REname), collapse = " ")))
}))
summary <- cbind(summary, REname)
}
seq <- as.character(summary$gRNAsPlusPAM)
cat("write gRNAs to bed file...\n")
on.target <- offTargets$offtargets
on.target <- unique(subset(on.target,
on.target$n.mismatch == 0 & on.target$isCanonicalPAM ==1))
# as.character(on.target$gRNAPlusPAM) == as.character(on.target$OffTargetSequence)))
if (dim(on.target)[1] >0)
{
gRNA.bed <- unique(cbind(as.character(on.target$chrom),as.character(on.target$chromStart),
as.character(on.target$chromEnd), as.character(on.target$name),
as.numeric(as.character(on.target$gRNAefficacy)) * 1000,
as.character(on.target$strand),
as.character(on.target$chromStart),
as.character(on.target$chromEnd)))
if (!useScore)
{
gRNA.bed <- cbind(gRNA.bed, rep("255,0,0",dim(gRNA.bed)[1]))
gRNA.bed[gRNA.bed[,6] == "-",9] = "0,255,0"
}
#### UCSC genome browser is 0-based instead of 1 based index
gRNA.bed[, 2] = as.numeric(gRNA.bed[, 2]) -1
gRNA.bed[, 3] = as.numeric(gRNA.bed[, 3])
gRNA.bed[gRNA.bed[,6] == "+" ,7] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "+" ,2]) +
min(overlap.gRNA.positions) - 1
gRNA.bed[gRNA.bed[,6] == "-" ,7] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "-" ,3]) -
max(overlap.gRNA.positions)
gRNA.bed[gRNA.bed[,6] == "+", 8] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "+", 2]) +
max(overlap.gRNA.positions)
gRNA.bed[gRNA.bed[,6] == "-", 8] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "-", 3]) -
min(overlap.gRNA.positions) + 1
write.table("track name=\"gRNA sites\" description=\"CRISPRseek\" visibility=2 useScore=1 itemRgb=\"On\"", file=bedFile, col.names=FALSE, row.names=FALSE, quote = FALSE)
write.table(gRNA.bed, file=bedFile, sep=" ", row.names=FALSE, col.names=FALSE, append=TRUE, quote = FALSE)
on.target <- unique(cbind(as.character(on.target$name),
as.character(on.target$forViewInUCSC),
as.character(on.target$extendedSequence),
as.character(on.target$gRNAefficacy)
))
colnames(on.target) = c("names", "forViewInUCSC", "extendedSequence", "gRNAefficacy")
if (useEfficacyFromInputSeq)
{
on.target <- as.data.frame(on.target[,1:2])
inputEfficacy <- read.table(efficacyFile, sep="\t", header = TRUE,
stringsAsFactors=FALSE)
inputEfficacy <- as.data.frame(cbind(name = inputEfficacy$name,
extendedSequence = inputEfficacy$extendedSequence,
gRNAefficacy = inputEfficacy$gRNAefficacy))
on.target <- merge(on.target, inputEfficacy, by.x="names", by.y ="name")
}
if(dim(on.target)[1] >0)
summary <- unique(merge(on.target, summary, by="names", all=TRUE))
write.table(summary[order(as.character(summary$names)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
cat("Scan for REsites in flanking region...\n")
if (outputUniqueREs && !missing(BSgenomeName) &&
class(BSgenomeName) == "BSgenome")
{
REs.isUnique100 <- uniqueREs(REcutDetails = REcutDetails,
summary = summary, offTargets$offtargets, scanUpstream = 100,
scanDownstream =100, BSgenomeName = BSgenomeName)
REs.isUnique50 <- uniqueREs(REcutDetails = REcutDetails,
summary = summary, offTargets$offtargets, scanUpstream = 50,
scanDownstream = 50, BSgenomeName = BSgenomeName)
summary <- cbind(summary, uniqREin200 = REs.isUnique100,
uniqREin100 = REs.isUnique50)
summary$uniqREin200 <- as.character(summary$uniqREin200)
summary$uniqREin100 <- as.character(summary$uniqREin100)
}
else
{
REs.isUnique100 = ""
REs.isUnique50 = ""
}
}
else
{
warnings("No on-target found for the input gRNAs with your search criteria!")
gRNA.bed = ""
REs.isUnique100 = ""
REs.isUnique50 = ""
}
if (foldgRNAs)
{
source(system.file("extdata/foldgRNAs.R",package = "CRISPRseek"))
gRNAs.withoutPAM <- substr(as.character(summary$gRNAsPlusPAM), 1, gRNA.size)
folded.gRNAs <- foldgRNAs(gRNAs.withoutPAM, gRNA.backbone = gRNA.backbone,
temperature = temperature)
if (length(dim(folded.gRNAs)) > 0)
{
if (dim(folded.gRNAs)[1] >1)
summary <- cbind(summary, folded.gRNAs[,-1])
else
summary <- data.frame(c(summary, folded.gRNAs[,-1]))
}
}
#write.table(summary[order(as.character(summary$forViewInUCSC)), ],
### even there is no perfect target for a gRNA, it will be kept in the summary file
### need to calculate the topN offtarget score and distance correctly yet if include those gRNAs without target
gRNAs.notInGenome <- setdiff(names(gRNAs), summary$names)
if (length(gRNAs.notInGenome) > 0)
{
dat2 <- data.frame(matrix(nrow = length(gRNAs.notInGenome), ncol = dim(summary)[2]))
colnames(dat2) <- colnames(summary)
dat2$names <- gRNAs.notInGenome
dat2$gRNAsPlusPAM <- paste(substr(as.character(gRNAs[names(gRNAs) %in% gRNAs.notInGenome]), 1, gRNA.size), PAM, sep ="")
summary <- rbind(summary, dat2)
}
if (dim(on.target)[1] == 0)
write.table(summary[order(as.character(summary$names)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
else
write.table(summary[order(as.character(summary$forViewInUCSC)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
if (predIndelFreq) {
if (predictIndelFreq.onTargetOnly)
targets <- unique(subset(offTargets$offtargets,
offTargets$offtargets$n.mismatch == 0 & offTargets$offtargets$isCanonicalPAM ==1))
else
targets <- subset(offTargets$offtargets, offTargets$offtargets$isCanonicalPAM == 1)
if (useBSgenome) {
extendedSequence <- getExtendedSequence(targets,
useBSgenome = TRUE,
BSgenomeName = BSgenomeName,
baseBeforegRNA = baseBeforegRNA.indelFreq,
baseAfterPAM = baseAfterPAM.indelFreq, forMethod = method.indelFreq)
}
else {
extendedSequence <- getExtendedSequence(targets,
useBSgenome = FALSE,
genomeSeq = genomeSeq,
baseBeforegRNA = baseBeforegRNA.indelFreq,
baseAfterPAM = baseAfterPAM.indelFreq, forMethod = method.indelFreq)
}
tryCatch((
indelFreqFS <- predictRelativeFreqIndels(extendedSequence, method = method.indelFreq)
), error = function(e) {print(e); })
if (exists("indelFreqFS"))
{
fs <- unlist(lapply(indelFreqFS, function(x) { x$fs }))
indelFreq <- lapply(indelFreqFS, function(x) {x$indel})
entropy <- unlist(lapply(indelFreq, function(x) {
if (length(x) > 1)
sum(-as.numeric(x[,2])/100 * log(as.numeric(x[,2])/100, base = 450), na.rm = TRUE)
else
NA
}))
fs2 <- data.frame(cbind(names = as.character(targets[,1]), frameshift = fs,
entropy = entropy, n.mismatch = as.character(targets$n.mismatch)))
fs2[,1] <- as.character(fs2[,1])
summary <- data.frame(summary)
summary[,1] <- as.character(summary[,1])
summary <- merge(subset(fs2, fs2[,4] == 0)[,-4], summary, all.y = TRUE)
write.table(summary[order(as.character(summary$forViewInUCSC)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
names(indelFreq) <- paste(targets[,1], targets[,2], targets[,3],
sep= ",")
if (!predictIndelFreq.onTargetOnly)
{
targets[,1] <- as.character(targets[,1])
fs2 <- cbind(OffTargetSequence = as.character(targets[,3]), fs2[, -1])
targets <- merge(targets, fs2, all.x = TRUE)
offTargets$offtargets <- targets
write.table(targets, file = paste(outputDir, "OfftargetAnalysis.xls", sep = ""),
sep = "\t", row.names = FALSE)
}
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50,
indelFreq = indelFreq)
}
else
{
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50)
}
}
else {
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50)
}
}
else
{
if (PAM.location == "3prime")
x <- paste(substr(as.character(gRNAs), 1, gRNA.size), PAM, sep ="")
else
x <- paste(PAM, substr(as.character(gRNAs), 1, gRNA.size), sep ="")
summary <- cbind(names = names(gRNAs), gRNAsPlusPAM = x,top5OfftargetTotalScore = rep("NA", length(gRNAs)),
top10OfftargetTotalScore = rep("NA", length(gRNAs)),
top1Hit.onTarget.MMdistance2PAM = rep("NA", length(gRNAs))
)
write.table(summary, file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
summary
}
}
LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Defines functions offTargetAnalysisWithoutBSgenome
Documented in offTargetAnalysisWithoutBSgenome
#' Design of target-specific guide RNAs for CRISPR-Cas9 system in one function
#' without BSgenome
#'
#' Design of target-specific guide RNAs (gRNAs) for CRISPR-Cas9 system without
#' BSgenome by automatically calling findgRNAs, filtergRNAs, searchHits,
#' buildFeatureVectorForScoring, getOfftargetScore, filterOfftarget,
#' calculating gRNA cleavage efficiency and generate reports.
#'
#' %% ~~ If necessary, more details than the description above ~~
#'
#' @param inputFilePath Sequence input file path or a DNAStringSet object that
#' contains sequences to be searched for potential gRNAs
#' @param format Format of the input file, fasta, fastq and bed are supported,
#' default fasta
#' @param header Indicate whether the input file contains header, default
#' FALSE, only applies to bed format
#' @param gRNAoutputName Specify the name of the gRNA outupt file when
#' inputFilePath is DNAStringSet object instead of file path
#' @param findgRNAs Indicate whether to find gRNAs from the sequences in the
#' input file or skip the step of finding gRNAs, default TRUE. Set it to FALSE
#' if the input file contains user selected gRNAs plus PAM already.
#' @param exportAllgRNAs Indicate whether to output all potential gRNAs to a
#' file in fasta format, genbank format or both. Default to both.
#' @param findgRNAsWithREcutOnly Indicate whether to find gRNAs overlap with
#' restriction enzyme recognition pattern
#' @param REpatternFile File path containing restriction enzyme cut patterns
#' @param minREpatternSize Minimum restriction enzyme recognition pattern
#' length required for the enzyme pattern to be searched for, default 4
#' @param overlap.gRNA.positions The required overlap positions of gRNA and
#' restriction enzyme cut site, default 17 and 18
#' @param findPairedgRNAOnly Choose whether to only search for paired gRNAs in
#' such an orientation that the first one is on minus strand called reverse
#' gRNA and the second one is on plus strand called forward gRNA. TRUE or
#' FALSE, default FALSE
#' @param annotatePaired Indicate whether to output paired information, default
#' TRUE
#' @param paired.orientation PAMin orientation means the two adjacent PAMs on
#' the sense and antisense strands face inwards towards each other like N21GG
#' and CCN21 whereas PAMout orientation means they face away from each other
#' like CCN21 and N21GG
#' @param min.gap Minimum distance between two oppositely oriented gRNAs to be
#' valid paired gRNAs. Default 0
#' @param enable.multicore Indicate whether enable parallel processing, default
#' FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE
#' @param n.cores.max Indicating maximum number of cores to use in multi core
#' mode, i.e., parallel processing, default 6. Please set it to 1 to disable
#' multicore processing for small dataset.
#' @param max.gap Maximum distance between two oppositely oriented gRNAs to be
#' valid paired gRNAs. Default 20
#' @param gRNA.name.prefix The prefix used when assign name to found gRNAs,
#' default gRNA, short for guided RNA.
#' @param PAM.size PAM length, default 3
#' @param gRNA.size The size of the gRNA, default 20
#' @param PAM PAM sequence after the gRNA, default NGG
#' @param BSgenomeName BSgenome object. Please refer to available.genomes in
#' BSgenome package. For example,
#' \itemize{
#' \item{BSgenome.Hsapiens.UCSC.hg19} - for hg19,
#' \item{BSgenome.Mmusculus.UCSC.mm10} - for mm10
#' \item{BSgenome.Celegans.UCSC.ce6} - for ce6
#' \item{BSgenome.Rnorvegicus.UCSC.rn5} - for rn5
#' \item{BSgenome.Drerio.UCSC.danRer7} - for Zv9
#' \item{BSgenome.Dmelanogaster.UCSC.dm3} - for dm3
#' }
#' @param chromToSearch Specify the chromosome to search, default to all,
#' meaning search all chromosomes. For example, chrX indicates searching for
#' matching in chromosome X only
#' @param chromToExclude Specify the chromosome not to search. If specified as
#' "", meaning to search chromosomes specified by chromToSearch. By default, to
#' exclude haplotype blocks from offtarget search in hg19, i.e., chromToExclude
#' = c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1", "chr6_cox_hap2",
#' "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6",
#' "chr6_ssto_hap7")
#' @param max.mismatch Maximum mismatch allowed in off target search, default
#' 3. Warning: will be considerably slower if set > 3
#' @param PAM.pattern Regular expression of protospacer-adjacent motif (PAM),
#' default NNG$|NGN$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM
#' sequence
#' @param allowed.mismatch.PAM Maximum number of mismatches allowed in the PAM
#' sequence for offtarget search, default to 1 for NNG or NGN PAM pattern for
#' offtarget finding.
#' @param gRNA.pattern Regular expression or IUPAC Extended Genetic Alphabet to
#' represent gRNA pattern, default is no restriction. To specify that the gRNA
#' must start with GG for example, then set it to ^GG. Please see
#' help(translatePattern) for a list of IUPAC Extended Genetic Alphabet.
#' @param baseEditing Indicate whether to design gRNAs for base editing.
#' Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and
#' editingWidow accordingly.
#' @param targetBase Applicable only when baseEditing is set to TRUE. It is
#' used to indicate the target base for base editing systems, default to C for
#' converting C to T in the CBE system. Please change it to A if you intend to
#' use the ABE system.
#' @param editingWindow Applicable only when baseEditing is set to TRUE. It is
#' used to indicate the effective editing window, default to 4 to 8 which is
#' for the original CBE system. Please change it accordingly if the system you
#' use have a different editing window.
#' @param editingWindow.offtargets Applicable only when baseEditing is set to
#' TRUE. It is used to indicate the effective editing window to consider for
#' the offtargets search only, default to 4 to 8 (1 means the most distal site
#' from the 3' PAM, the most proximla site from the 5' PAM), which is for the
#' original CBE system. Please change it accordingly if the system you use
#' have a different editing window, or you would like to include offtargets
#' with the target base in a larger editing window.
#' @param primeEditing Indicate whether to design gRNAs for prime editing.
#' Default to FALSE. If true, please set PBS.length, RT.template.length,
#' RT.template.pattern, targeted.seq.length.change, bp.after.target.end,
#' target.start, and target.end accordingly
#' @param PBS.length Applicable only when primeEditing is set to TRUE. It is
#' used to specify the number of bases to ouput for primer binding site.
#' @param RT.template.length Applicable only when primeEditing is set to TRUE.
#' It is used to specify the number of bases required for RT template, default
#' to 8 to 18. Please increase the length if the edit is large insertion. Only
#' gRNAs with calculated RT.template.length falling into the specified range
#' will be in the output. It is calculated as the following. RT.template.length
#' = target.start – cut.start + (target.end - target.start) +
#' targeted.seq.length.change + bp.after.target.end
#' @param RT.template.pattern Applicable only when primeEditing is set to TRUE.
#' It is used to specify the RT template sequence pattern, default to not
#' ending with C according to https://doi.org/10.1038/s41586-019-1711-4
#' @param corrected.seq Applicable only when primeEditing is set to TRUE. It is
#' used to specify the mutated or inserted sequences after successful editing.
#' @param targeted.seq.length.change Applicable only when primeEditing is set
#' to TRUE. It is used to specify the number of targeted sequence length
#' change. Please set it to 0 for base changes, positive numbers for insersion,
#' and negative number for deletion. For example, 10 means that the corrected
#' sequence will have 10bp insertion, -10 means that the corrected sequence
#' will have 10bp deletion, and 0 means only bases have been changed and the
#' sequence length remains the same
#' @param bp.after.target.end Applicable only when primeEditing is set to TRUE.
#' It is used to specify the number of bases to add after the target change end
#' site as part of RT template. Please refer to RT.template.length for how this
#' parameter influences the RT.template.length calculation which is used as a
#' filtering criteria in pregRNA selection.
#' @param target.start Applicable only when primeEditing is set to TRUE. It is
#' used to specify the start location in the input sequence to make changes,
#' which will be used to obtain the RT template sequence. Please also refer to
#' RT.template.length for how this parameter influences the RT.template.length
#' calculation which is used as a filtering criteria in pregRNA selection.
#' @param target.end Applicable only when primeEditing is set to TRUE. It is
#' used to specify the end location in the input sequnence to make changes,
#' which will be used to obtain the RT template sequence. Please also refer to
#' RT.template.length for how this parameter influences the RT.template.length
#' calculation which is used as a filtering criteria in pregRNA selection.
#' @param primeEditingPaired.output Applicable only when primeEditing is set to
#' TRUE. It is used to specify the file path to save pegRNA and the second gRNA
#' with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls
#' @param min.score minimum score of an off target to included in the final
#' output, default 0
#' @param topN top N off targets to be included in the final output, default
#' 1000
#' @param topN.OfftargetTotalScore top N off target used to calculate the total
#' off target score, default 10
#' @param annotateExon Choose whether or not to indicate whether the off target
#' is inside an exon or not, default TRUE
#' @param txdb TxDb object, for creating and using TxDb object, please refer to
#' GenomicFeatures package. For a list of existing TxDb object, please search
#' for annotation package starting with Txdb at
#' http://www.bioconductor.org/packages/release/BiocViews.html#___AnnotationData,
#' such as
#' \itemize{
#' \item{TxDb.Rnorvegicus.UCSC.rn5.refGene} - {for rat}
#' \item{TxDb.Mmusculus.UCSC.mm10.knownGene} - {for mouse}
#' \item{TxDb.Hsapiens.UCSC.hg19.knownGene} - {for human}
#' \item{TxDb.Dmelanogaster.UCSC.dm3.ensGene} - {for Drosophila}
#' \item{TxDb.Celegans.UCSC.ce6.ensGene} - {for C.elegans}
#' }
#' @param orgAnn organism annotation mapping such as org.Hs.egSYMBOL in
#' org.Hs.eg.db package for human
#' @param ignore.strand default to TRUE when annotating to gene
#' @param outputDir the directory where the off target analysis and reports
#' will be written to
#' @param fetchSequence Fetch flank sequence of off target or not, default TRUE
#' @param upstream upstream offset from the off target start, default 200
#' @param downstream downstream offset from the off target end, default 200
#' @param upstream.search upstream offset from the bed input starts to search
#' for gRNAs, default 0
#' @param downstream.search downstream offset from the bed input ends to search
#' for gRNAs, default 0
#' @param weights Applicable only when scoring.method is set to Hsu-Zhang a
#' numeric vector size of gRNA length, default c(0, 0, 0.014, 0, 0, 0.395,
#' 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615,
#' 0.804, 0.685, 0.583) which is used in Hsu et al., 2013 cited in the
#' reference section
#' @param baseBeforegRNA Number of bases before gRNA used for calculating gRNA
#' efficiency, default 4 Please note, for PAM located on the 5 prime, need to
#' specify the number of bases before the PAM sequence plus PAM size.
#' @param baseAfterPAM Number of bases after PAM used for calculating gRNA
#' efficiency, default 3 for spCas9 Please note, for PAM located on the 5
#' prime, need to include the length of the gRNA plus the extended sequence on
#' the 3 prime
#' @param featureWeightMatrixFile Feature weight matrix file used for
#' calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used.
#' To use alternative weight matrix file, please input a csv file with first
#' column containing significant features and the second column containing the
#' corresponding weights for the features. Please see Doench et al., 2014 for
#' details.
#' @param useScore Default TRUE, display in gray scale with the darkness
#' indicating the gRNA efficacy. The taller bar shows the Cas9 cutting site.
#' If set to False, efficacy will not show. Instead, gRNAs in plus strand will
#' be colored red and gRNAs in negative strand will be colored green.
#' @param useEfficacyFromInputSeq Default FALSE. If set to TRUE, summary file
#' will contain gRNA efficacy calculated from input sequences instead of from
#' off-target analysis. Set it to TRUE if the input sequence is from a
#' different species than the one used for off-target analysis.
#' @param outputUniqueREs Default TRUE. If set to TRUE, summary file will
#' contain REs unique to the cleavage site within 100 or 200 bases surrounding
#' the gRNA sequence.
#' @param foldgRNAs Default FALSE. If set to TRUE, summary file will contain
#' minimum free energy of the secondary structure of gRNA with gRNA backbone
#' from GeneRfold package provided that GeneRfold package has been installed.
#' @param gRNA.backbone gRNA backbone constant region sequence. Default to the
#' sequence in Sp gRNA backbone.
#' @param temperature temperature in celsius. Default to 37 celsius.
#' @param overwrite overwrite the existing files in the output directory or
#' not, default FALSE
#' @param scoring.method Indicates which method to use for offtarget cleavage
#' rate estimation, currently two methods are supported, Hsu-Zhang and CFDscore
#' @param subPAM.activity Applicable only when scoring.method is set to
#' CFDscore A hash to represent the cleavage rate for each alternative sub PAM
#' sequence relative to preferred PAM sequence
#' @param subPAM.position Applicable only when scoring.method is set to
#' CFDscore The start and end positions of the sub PAM. Default to 22 and 23
#' for spCas9 with 20bp gRNA and NGG as preferred PAM. For Cpf1, it could be
#' c(1,2).
#' @param PAM.location PAM location relative to gRNA. For example, default to
#' 3prime for spCas9 PAM. Please set to 5prime for cpf1 PAM since it's PAM is
#' located on the 5 prime end
#' @param rule.set Specify a rule set scoring system for calculating gRNA
#' efficacy. Please note that Root_RuleSet2_2016 requires the following python
#' packages with specified verion and python 2.7. 1. scikit-learn 0.16.1 2.
#' pickle 3. pandas 4. numpy 5. scipy
#' @param chrom_acc Optional binary variable indicating chromatin accessibility
#' information with 1 indicating accessible and 0 not accessible.
#' @param mismatch.activity.file Applicable only when scoring.method is set to
#' CFDscore A comma separated (csv) file containing the cleavage rates for all
#' possible types of single nucleotide mismatche at each position of the gRNA.
#' By default, using the supplemental Table 19 from Doench et al., Nature
#' Biotechnology 2016
#' @param useBSgenome Specify whether BSgenome is avaialbe for searching for
#' gRNA and offtargets, default to FALSE. If set it to TRUE, the results should
#' be the same as when using offtargetAnalysis function.
#' @param genomeSeqFile Specify the genome sequence file in fasta format. It is
#' only applicable and required when useBSgenome is set to FALSE.
#' @param predIndelFreq Default to FALSE. Set it to TRUE to output the
#' predicted indels and their frequencies.
#' @param predictIndelFreq.onTargetOnly Default to TRUE, indicating that indels
#' and their frequencies will be predicted for ontargets only. Usually,
#' researchers are only interested in predicting the editing outcome for the
#' ontargets since any editing in the offtargets are unwanted. Set it to FALSE
#' if you are interested in predicting indels and their frequencies for
#' offtargets. It will take longer time to run if you set it to FALSE.
#' @param method.indelFreq Currently only Lindel method has been implemented.
#' Please let us know if you think additional methods should be made available.
#' Lindel is compatible with both Python2.7 and Python3.5 or higher. Please
#' type help(predictRelativeFreqIndels) to get more details.
#' @param baseBeforegRNA.indelFreq Default to 13 for Lindel method.
#' @param baseAfterPAM.indelFreq Default to 24 for Lindel method.
#' @return Four tab delimited files are generated in the output directory:
#' \item{OfftargetAnalysis.xls}{ - detailed information of off targets}
#' \item{Summary.xls}{ - summary of the gRNAs}
#' \item{REcutDetails.xls}{ - restriction enzyme cut sites of each gRNA}
#' \item{pairedgRNAs.xls}{ - potential paired gRNAs}
#' @note %% ~~further notes~~
#' @author Lihua Julie Zhu
#' @seealso CRISPRseek
#' @references Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran,
#' Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
#' Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao & Feng Zhang
#' (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
#' Biotechnology 31:827-834
#'
#' Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M,
#' Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for
#' CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi:
#' 10.1038 nbt.3026
#'
#' Lihua Julie Zhu, Benjamin R. Holmes, Neil Aronin and Michael Brodsky.
#' CRISPRseek: a Bioconductor package to identify target-specific guide RNAs
#' for CRISPR-Cas9 genome-editing systems. Plos One Sept 23rd 2014
#'
#' Moreno-Mateos, M., Vejnar, C., Beaudoin, J. et al. CRISPRscan: designing
#' highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods 12,
#' 982–988 (2015) doi:10.1038/nmeth.3543
#'
#' Doench JG et al., Optimized sgRNA design to maximize activity and minimize
#' off-target effects of CRISPR-Cas9. Nature Biotechnology Jan 18th 2016
#'
#' Anzalone et al., Search-and-replace genome editing without double-strand
#' breaks or donor DNA. Nature October 2019
#' https://www.nature.com/articles/s41586-019-1711-4
#'
#' Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel
#' profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated
#' double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05
#' September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487
#' @keywords misc
#' @examples
#'
#' library(CRISPRseek)
#' inputFilePath <- system.file("extdata", "inputseqWithoutBSgenome.fa",
#' package = "CRISPRseek")
#' ########### genomeSeq.fasta contains the genomic sequence in fasta format for gRNA and offtarget search###############
#' genomeSeqFile <- system.file("extdata", "genomeSeq.fasta",
#' package = "CRISPRseek")
#' library(hash)
#' subPAM.activity <- hash(AA = 0, AC = 0, AG = 0.259259259,
#' AT = 0, CA = 0, CC = 0, CG = 0.107142857, CT = 0, GA = 0.069444444,
#' GC = 0.022222222, GG = 1, GT = 0.016129032, TA = 0, TC = 0,
#' TG = 0.038961039, TT = 0)
#' featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
#' package = "CRISPRseek")
#' results <- offTargetAnalysisWithoutBSgenome(inputFilePath = inputFilePath,
#' format = "fasta",
#' useBSgenome = FALSE,
#' genomeSeqFile = genomeSeqFile,
#' findgRNAs = TRUE,
#' exportAllgRNAs = "fasta",
#' fetchSequence = FALSE,
#' findgRNAsWithREcutOnly = FALSE,
#' findPairedgRNAOnly = FALSE,
#' annotatePaired = FALSE,
#' max.mismatch = 1,
#' annotateExon = FALSE,
#' scoring.method = "CFDscore",
#' min.score = 0.01,
#' PAM = "NGG",
#' PAM.pattern <- "NNN",
#' rule.set = "CRISPRscan",
#' featureWeightMatrixFile = featureWeightMatrixFile,
#' subPAM.activity = subPAM.activity,
#' outputDir = "gRNAoutput-CRISPRseek-CRISPRscan-CFDscore", overwrite = TRUE)
#' @importFrom hash hash
#' @importFrom utils read.csv write.table read.table
#' @importFrom GenomicRanges intersect setdiff
#' @importFrom Biostrings writeXStringSet readDNAStringSet
#' @importFrom BiocGenerics rbind cbind unlist lapply
#' @export
offTargetAnalysisWithoutBSgenome <-
function(inputFilePath, format = "fasta", header=FALSE,
gRNAoutputName, findgRNAs = TRUE,
exportAllgRNAs = c("all", "fasta", "genbank", "no"),
findgRNAsWithREcutOnly = FALSE,
REpatternFile = system.file("extdata", "NEBenzymes.fa",
package = "CRISPRseek"),
minREpatternSize = 4,
overlap.gRNA.positions = c(17, 18), findPairedgRNAOnly = FALSE,
annotatePaired = TRUE, paired.orientation = c("PAMout","PAMin"),
enable.multicore = FALSE, n.cores.max = 6,
min.gap = 0, max.gap = 20, gRNA.name.prefix = "",
PAM.size = 3, gRNA.size = 20, PAM = "NGG", BSgenomeName,
chromToSearch = "all",
chromToExclude = c("chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1",
"chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6",
"chr6_ssto_hap7"),
max.mismatch = 3,
PAM.pattern = "NNG$|NGN$", allowed.mismatch.PAM = 1,
gRNA.pattern = "",
baseEditing = FALSE, targetBase = "C", editingWindow = 4:8,
editingWindow.offtargets = 4:8,
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.score = 0, topN = 1000,
topN.OfftargetTotalScore = 10,
annotateExon = TRUE, txdb, orgAnn, ignore.strand = TRUE, outputDir,
fetchSequence = TRUE, upstream = 200, downstream = 200,
upstream.search = 0, downstream.search = 0,
weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445,
0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583),
baseBeforegRNA = 4, baseAfterPAM = 3,
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv",
package = "CRISPRseek"),
useScore = TRUE, useEfficacyFromInputSeq = FALSE,
outputUniqueREs = TRUE, foldgRNAs = FALSE,
gRNA.backbone="GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU",
temperature = 37,
overwrite = FALSE,
scoring.method = c("Hsu-Zhang", "CFDscore"),
subPAM.activity = hash( AA =0,
AC = 0,
AG = 0.259259259,
AT = 0,
CA = 0,
CC = 0,
CG = 0.107142857,
CT = 0,
GA = 0.069444444,
GC = 0.022222222,
GG = 1,
GT = 0.016129032,
TA = 0,
TC = 0,
TG = 0.038961039,
TT = 0),
subPAM.position = c(22, 23),
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc,
mismatch.activity.file = system.file("extdata",
"NatureBiot2016SuppTable19DoenchRoot.csv",
package = "CRISPRseek"),
useBSgenome = FALSE, genomeSeqFile,
predIndelFreq = FALSE,
predictIndelFreq.onTargetOnly = TRUE,
method.indelFreq = "Lindel",
baseBeforegRNA.indelFreq = 13,
baseAfterPAM.indelFreq = 24
)
{
cat("Validating input ...\n")
scoring.method <- match.arg(scoring.method)
exportAllgRNAs <- match.arg(exportAllgRNAs)
rule.set <- match.arg(rule.set)
exportAllgRNAs <- match.arg(exportAllgRNAs)
paired.orientation <- match.arg(paired.orientation)
PAM.p.letters <- strsplit(PAM.pattern, split="")[[1]]
if (PAM.location == "3prime" && PAM.p.letters[length(PAM.p.letters)] != "$")
PAM.pattern <- paste0(PAM.pattern, "$")
if (PAM.location == "5prime" && PAM.p.letters[1] != "^")
PAM.pattern <- paste0("^", PAM.pattern)
if (rule.set == "DeepCpf1")
{
baseBeforegRNA <- 8
baseAfterPAM <- 26
if (scoring.method == "CFDscore" && subPAM.activity$TT < 1)
subPAM.activity = hash( AA =0,
AC = 0,
AG = 0,
AT = 0.1,
CA = 0,
CC = 0,
CG = 0,
CT = 0.05,
GA = 0,
GC = 0,
GG = 0,
GT = 0.05,
TA = 0.2,
TC = 0.1,
TG = 0.1,
TT = 1)
}
else if (rule.set %in% c("Root_RuleSet1_2014",
"Root_RuleSet2_2016", "CRISPRscan"))
{
if (PAM.location == "3prime")
{
baseBeforegRNA <- 4
baseAfterPAM <- 3
}
else
{
baseBeforegRNA <- 4 + PAM.size
baseAfterPAM <- 3 + gRNA.size
}
}
if (scoring.method == "CFDscore")
{
mismatch.activity <- read.csv(mismatch.activity.file)
required.col <- c("Mismatch.Type", "Position", "Percent.Active")
if (length(intersect(colnames(mismatch.activity), required.col)) !=
length(required.col))
stop("Please rename the mismatch activity file column to contain at least
these 3 column names: Mismatch.Type, Position, Percent.Active\n")
}
else if (scoring.method == "Hsu-Zhang")
{
if (length(weights) != gRNA.size)
stop("Please make sure the size of weights vector
equals to the gRNA.size!\n")
}
if(findgRNAsWithREcutOnly && findgRNAs && !file.exists(REpatternFile))
{
stop("Please specify an REpattern file as fasta file with
restriction enzyme recognition sequences!")
}
if (missing(inputFilePath)) {
stop("inputFilePath containing the searching sequence, coordinate or a DNAStringSet
object is required!")
}
if (substr(outputDir, nchar(outputDir), nchar(outputDir)) != .Platform$file.sep)
{
outputDir <- paste(outputDir, "", sep = .Platform$file.sep)
}
if (file.exists(outputDir) && ! overwrite)
{
cat(outputDir, "exists already. Please type 1 if you want to
overwrite the outputDir and 2 if you want to exit.", fill = TRUE)
input <- readline()
if(input != 1) { stop("Please change the outputDir!") }
}
if (!file.exists(outputDir))
{
dir.create(outputDir)
}
if (annotatePaired || findPairedgRNAOnly)
pairOutputFile <- paste(outputDir, "pairedgRNAs.xls", sep = "")
REcutDetailFile <- paste(outputDir, "REcutDetails.xls", sep = "")
bedFile<- paste(outputDir, "gRNAsCRISPRseek.bed", sep = "")
if (missing(gRNAoutputName) && class(inputFilePath) == "DNAStringSet")
stop("Please enter a name for the gRNA ouput file name when DNAStringSet instead of file path provided!")
if (class(inputFilePath) != "DNAStringSet" && missing(gRNAoutputName))
gRNAoutputName = strsplit(basename(inputFilePath), split=".",
fixed=TRUE)[[1]][1]
if (format =="bed")
{
if (missing(BSgenomeName) || class(BSgenomeName) != "BSgenome") {
stop("BSgenomeName is required as BSgenome object when input file is in bed format!")
}
inputFilePath <- getSeqFromBed(inputFilePath, header = header, BSgenomeName = BSgenomeName)
#### format for filtergRNAs
format <- "fasta"
}
if (findgRNAs)
{
cat("Searching for gRNAs ...\n")
efficacyFile <- paste(outputDir, "gRNAefficacy.xls", sep = "")
if ((length(chromToSearch) == 1 && chromToSearch == "") || useEfficacyFromInputSeq)
potential.gRNAs <- findgRNAs(inputFilePath,
overlap.gRNA.positions = overlap.gRNA.positions,
baseEditing = baseEditing, targetBase = targetBase, editingWindow = editingWindow,
primeEditing = primeEditing,
findPairedgRNAOnly = findPairedgRNAOnly,
annotatePaired = annotatePaired,
paired.orientation = paired.orientation,
pairOutputFile = pairOutputFile, PAM = PAM,
PAM.location = PAM.location,
gRNA.pattern = gRNA.pattern, PAM.size = PAM.size,
gRNA.size = gRNA.size, min.gap = min.gap,
max.gap = max.gap, name.prefix = gRNA.name.prefix,
format = format, featureWeightMatrixFile = featureWeightMatrixFile,
baseBeforegRNA = baseBeforegRNA,
baseAfterPAM = baseAfterPAM ,
calculategRNAEfficacy = TRUE, efficacyFile = efficacyFile,
rule.set = rule.set, chrom_acc = chrom_acc)
else
potential.gRNAs <- findgRNAs(inputFilePath,
overlap.gRNA.positions = overlap.gRNA.positions,
baseEditing = baseEditing, targetBase = targetBase, editingWindow = editingWindow,
primeEditing = primeEditing,
PBS.length = PBS.length,
RT.template.length = RT.template.length,
RT.template.pattern = RT.template.pattern,
corrected.seq = corrected.seq,
targeted.seq.length.change = targeted.seq.length.change,
bp.after.target.end = bp.after.target.end,
target.start = target.start,
target.end = target.end,
primeEditingPaired.output = primeEditingPaired.output,
findPairedgRNAOnly = findPairedgRNAOnly,
annotatePaired = annotatePaired,
paired.orientation = paired.orientation,
enable.multicore = enable.multicore,
n.cores.max = n.cores.max,
pairOutputFile = pairOutputFile, PAM = PAM,
gRNA.pattern = gRNA.pattern, PAM.size = PAM.size,
PAM.location = PAM.location,
gRNA.size = gRNA.size, min.gap = min.gap,
max.gap = max.gap, name.prefix = gRNA.name.prefix,
format = format, rule.set = rule.set, chrom_acc = chrom_acc)
if (length(potential.gRNAs) == 0)
{
return(cat("no gRNAs found!"))
}
if (length(potential.gRNAs) > 0 && (exportAllgRNAs == "fasta" || exportAllgRNAs == "all"))
{
writeXStringSet(potential.gRNAs, filepath= file.path(outputDir,
paste(gRNAoutputName,"allgRNAs.fa", sep="")))
}
if (length(potential.gRNAs) > 0 && (exportAllgRNAs == "genbank" || exportAllgRNAs == "all"))
{
if (class(inputFilePath) == "DNAStringSet")
subjects <- inputFilePath
else
subjects <- readDNAStringSet(inputFilePath, format=format,
use.names = TRUE)
names(subjects) <- gsub( "\t", "", names(subjects))
names(subjects) <- gsub( "\n", "", names(subjects))
names(subjects) <- gsub( " ", "", names(subjects))
locuses <- names(subjects)
names.gRNA <- names(potential.gRNAs)
for (i in 1:length(locuses))
{
thisLocus <- gsub("'", "", locuses[i])
thisLocus <- gsub(" ", "", thisLocus)
thisSeq <- tolower(as.character(subjects[[i]]))
n.bp <- nchar(thisSeq)
temp <- strsplit(names.gRNA, split=paste(
thisLocus,"_gR",sep=""))
locus <- paste("LOCUS ", thisLocus,
" ", n.bp,
" bp dna linear UNK", sep="")
definition <- paste("DEFINITION CRISPRseek output for ",
gRNAoutputName, " sequence", sep = "")
accession <- "ACCESSION unknown"
features <- "FEATURES Location/Qualifiers"
header = rbind(locus, definition, accession, features)
found.gRNA <- 0
for (j in 1:length(temp))
{
if (length(temp[[j]]) >1){
found.gRNA <- found.gRNA + 1
if (found.gRNA == 1)
{
thisFile <- file.path(outputDir,
paste(thisLocus, "gbk", sep="."))
write(header, thisFile)
}
if (length(grep("f", temp[[j]])) >0)
{
temp1 <-strsplit(temp[[j]], "f")
isForward <- TRUE
}
else
{
temp1 <-strsplit(temp[[j]], "r")
isForward <- FALSE
}
feature <- temp1[[2]][2]
feature[is.na(feature)] <- ""
location <- temp1[[2]][1]
if (isForward)
{
Start <- location
End <- as.numeric(Start) + max(overlap.gRNA.positions) -
min(overlap.gRNA.positions)
write(paste(" misc_bind ", Start, "..",
End, sep = ""), append = TRUE, sep="\n",
file = thisFile)
write(paste(" /note=\"gRNAf",
as.character(feature),
"\"", sep = ""), append = TRUE, sep="\n", file = thisFile)
}
else
{
End <- location
Start <- as.numeric(End) - max(overlap.gRNA.positions) +
min(overlap.gRNA.positions)
write(paste(" misc_bind complement(",
Start, "..", End, ")", sep = ""),
append = TRUE, sep="\n", file = thisFile)
write(paste(" /note=\"gRNAr",
feature,
"\"", sep = ""), append = TRUE, sep="\n", file = thisFile)
}
}
}
if (found.gRNA > 0){
write("ORIGIN", append = TRUE, sep="\n", file = thisFile)
seq.lines <- floor(nchar(thisSeq) / 60) + 1
for (k in 1:seq.lines) {
line.start <- (k - 1) * 60 + 1
line.end <- min(line.start + 59, nchar(thisSeq))
n.leading.spaces <- 9 - nchar(line.start)
leading.spaces <- paste(rep(" ", n.leading.spaces),
collapse = "")
seq.thisLine <- substr(thisSeq, line.start, line.end)
len.thisLine <- nchar(seq.thisLine)
n.seg <- floor(len.thisLine /10) + 1
for (l in 1:n.seg) {
seg.start <- (l -1) * 10 + 1
seg.end <- min(seg.start + 9, len.thisLine)
if (l == 1)
seq.thisLine.formatted <- substr(seq.thisLine,
seg.start, seg.end)
else
seq.thisLine.formatted <- paste(
seq.thisLine.formatted,
substr(seq.thisLine, seg.start, seg.end),
sep = " ")
}
write(paste(leading.spaces, line.start, " ",
seq.thisLine.formatted, sep = ""),
append = TRUE, sep="\n", file = thisFile)
}
write("//", append = TRUE, sep="\n", file = thisFile)
}
}
}
if (findPairedgRNAOnly && length(potential.gRNAs) >0)
{
gRNAs.RE <- filtergRNAs(potential.gRNAs,
pairOutputFile = pairOutputFile,
findgRNAsWithREcutOnly = findgRNAsWithREcutOnly,
REpatternFile = REpatternFile,
format = format, minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(REcutDetails[order(as.character(
REcutDetails$ForwardgRNAName)), ], file = REcutDetailFile,
sep = "\t", row.names = FALSE)
}
else if (length(potential.gRNAs) >0)
{
gRNAs.RE <- filtergRNAs(potential.gRNAs,
findgRNAsWithREcutOnly = findgRNAsWithREcutOnly,
REpatternFile = REpatternFile, format = format,
minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(REcutDetails[order(as.character(
REcutDetails$REcutgRNAName)), ], file = REcutDetailFile,
sep = "\t", row.names = FALSE)
}
if (findgRNAsWithREcutOnly)
{
gRNAs <- gRNAs.RE$gRNAs
}
else
{
gRNAs <- potential.gRNAs
}
if ( annotatePaired || findPairedgRNAOnly)
pairedInformation <- read.table(pairOutputFile, sep = "\t",
header = TRUE, stringsAsFactors = FALSE)
}
else
{
if (class(inputFilePath) != "DNAStringSet")
{
if (! file.exists(inputFilePath)) {
stop("inputfile specified as ", inputFilePath, " does not exists!")
}
if (format == "fasta" || format == "fastq")
{
potential.gRNAs <- readDNAStringSet(inputFilePath, format,
use.names = TRUE)
}
else
{
stop("format needs to be either fasta,fastq or bed!")
}
}
else
{
potential.gRNAs <- inputFilePath
if (length(names(potential.gRNAs)) == 0)
names(potential.gRNAs) <- paste("gRNAs", 1:length(potential.gRNAs), sep="")
}
gRNAs.RE <- filtergRNAs(potential.gRNAs,
REpatternFile = REpatternFile, format = format,
minREpatternSize = minREpatternSize,
overlap.gRNA.positions = overlap.gRNA.positions)
REcutDetails <- gRNAs.RE$gRNAREcutDetails
write.table(
REcutDetails[order(as.character(REcutDetails$REcutgRNAName)), ],
file = REcutDetailFile, sep = "\t", row.names = FALSE)
if (findgRNAsWithREcutOnly)
{
gRNAs <- gRNAs.RE$gRNAs
}
else
{
gRNAs <- potential.gRNAs
}
pairedInformation <- ""
}
if (length(chromToSearch) == 1 && chromToSearch == "")
{
cat("Done. Please check output files in directory ", outputDir, "\n")
return(gRNAs)
}
if (useBSgenome && (missing(BSgenomeName) || class(BSgenomeName) != "BSgenome")) {
stop("BSgenomeName is required as BSgenome object when useBSgenome is set to true for offtarget search!")
}
if (!useBSgenome && missing(genomeSeqFile))
stop("To perform offtarget search with useBSgenome set to FALSE, genomeSeqFile needs to be set to a genome sequence file in fasta format!\n")
if (annotateExon && (missing(txdb) || (class(txdb) != "TxDb" &&
class(txdb) != "TranscriptDb")))
{
stop("To indicate whether an offtarget is inside an exon, txdb is
required as TxDb object!")
}
names(gRNAs) <- gsub( "\t", "", names(gRNAs))
names(gRNAs) <- gsub( "\n", "", names(gRNAs))
names(gRNAs) <- gsub( " ", "", names(gRNAs))
if (useBSgenome) {
hits <- searchHits2(gRNAs = gRNAs, PAM = PAM, PAM.pattern = PAM.pattern,
BSgenomeName = BSgenomeName, chromToSearch = chromToSearch,
chromToExclude = chromToExclude,
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size, allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets)
}
else {
genomeSeq <- readDNAStringSet(genomeSeqFile)
if (length(chromToSearch) == 1 && tolower(chromToSearch) == "all")
chromInd <- 1:length(genomeSeq)
else
chromInd <- which(names(genomeSeq) %in% chromToSearch)
chromInd <- setdiff(chromInd, which(names(genomeSeq) %in% chromToExclude))
outfile <- tempfile(tmpdir = getwd())
for (j in chromInd) {
if (j == chromInd[1])
hits <- searchHits(gRNAs = gRNAs,
seqs = genomeSeq[[j]],
seqname = names(genomeSeq)[j],
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size,
allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets,
outfile = outfile)
else
hits <- rbind(hits, searchHits(gRNAs = gRNAs,
PAM = PAM, PAM.pattern = PAM.pattern,
seqs = genomeSeq[[j]],
seqname = names(genomeSeq)[j],
max.mismatch = max.mismatch, PAM.size = PAM.size,
gRNA.size = gRNA.size,
allowed.mismatch.PAM = allowed.mismatch.PAM,
PAM.location = PAM.location,
baseEditing = baseEditing, targetBase = targetBase,
editingWindow = editingWindow.offtargets,
outfile = outfile))
}
}
if (dim(hits)[1] > 0)
{
cat("Building feature vectors for scoring ...\n")
#save(hits, file = "hits.RData")
featureVectors <- buildFeatureVectorForScoring(hits = hits,
canonical.PAM = PAM, gRNA.size = gRNA.size,
subPAM.position = subPAM.position,
PAM.location = PAM.location, PAM.size = PAM.size)
cat("Calculating scores ...\n")
if ( scoring.method == "CFDscore")
scores <- getOfftargetScore2(featureVectors,
subPAM.activity = subPAM.activity,
mismatch.activity.file = mismatch.activity.file)
else
scores <- getOfftargetScore(featureVectors, weights = weights)
#write.table(scores, file="testScore2.xls", sep="\t", row.names=FALSE)
cat("Annotating, filtering and generating reports ...\n")
#saveRDS(scores, file="scores.RDS")
offTargets <- filterOffTargetWithoutBSgenome(scores = scores, outputDir = outputDir,
BSgenomeName = BSgenomeName, fetchSequence = fetchSequence, txdb = txdb,
orgAnn = orgAnn, ignore.strand = ignore.strand,
min.score = min.score, topN = topN,
topN.OfftargetTotalScore = topN.OfftargetTotalScore,
upstream = upstream, downstream = downstream,
annotateExon = annotateExon, baseBeforegRNA = baseBeforegRNA,
baseAfterPAM = baseAfterPAM,
gRNA.size = gRNA.size,
PAM.location = PAM.location, PAM.size = PAM.size,
featureWeightMatrixFile = featureWeightMatrixFile,
rule.set = rule.set, chrom_acc = chrom_acc,
useBSgenome = useBSgenome, genomeSeq = genomeSeq)
# saveRDS(offTargets, file = "offTargets.RDS")
cat("Done annotating\n")
summary <- read.table(paste(outputDir, "Summary.xls", sep = ""), sep = "\t",
header = TRUE, stringsAsFactors = FALSE)
if (dim(summary)[2] == 1)
summary <- as.data.frame(t(data.matrix(offTargets$summary)))
for (i in grep("topOfftarget", names(summary)))
{
y <- as.character(summary[,i])
y[is.na(y)] <- ""
summary[, i] = y
}
if (findgRNAs && (annotatePaired || findPairedgRNAOnly))
{
cat("Add paired information...\n")
PairedgRNAName <- unlist(lapply(1:dim(summary)[1], function(i) {
as.character(gsub("^\\s+|\\s+$", "",
paste(unique(pairedInformation[as.character(
pairedInformation$ForwardgRNAName) == as.character(
summary$names[i]),]$ReversegRNAName),
unique(pairedInformation[as.character(
pairedInformation$ReversegRNAName) == as.character(
summary$names[i]),]$ForwardgRNAName),
collapse = " ")))
}))
}
cat("Add RE information...\n")
if (findPairedgRNAOnly && findgRNAs)
{
REname <- unlist(lapply(1:dim(summary)[1], function(i) {
gsub("^\\s+|\\s+$", "", gsub("NA", "",
paste(unique(REcutDetails[as.character(
REcutDetails$ForwardREcutgRNAName) == as.character(
summary$names[i]),]$ForwardREname),
unique(REcutDetails[as.character(
REcutDetails$ReverseREcutgRNAName) ==
as.character(summary$names[i]), ]$ReverseREname),
collapse = " ")))
}))
summary <- cbind(summary, PairedgRNAName, REname)
}
else
{
REname <- unlist(lapply(1:dim(summary)[1], function(i) {
gsub("^\\s+|\\s+$", "", gsub("NA", "", paste(unique(
REcutDetails[as.character(REcutDetails$REcutgRNAName) ==
as.character(summary$names[i]), ]$REname), collapse = " ")))
}))
summary <- cbind(summary, REname)
}
seq <- as.character(summary$gRNAsPlusPAM)
cat("write gRNAs to bed file...\n")
on.target <- offTargets$offtargets
on.target <- unique(subset(on.target,
on.target$n.mismatch == 0 & on.target$isCanonicalPAM ==1))
# as.character(on.target$gRNAPlusPAM) == as.character(on.target$OffTargetSequence)))
if (dim(on.target)[1] >0)
{
gRNA.bed <- unique(cbind(as.character(on.target$chrom),as.character(on.target$chromStart),
as.character(on.target$chromEnd), as.character(on.target$name),
as.numeric(as.character(on.target$gRNAefficacy)) * 1000,
as.character(on.target$strand),
as.character(on.target$chromStart),
as.character(on.target$chromEnd)))
if (!useScore)
{
gRNA.bed <- cbind(gRNA.bed, rep("255,0,0",dim(gRNA.bed)[1]))
gRNA.bed[gRNA.bed[,6] == "-",9] = "0,255,0"
}
#### UCSC genome browser is 0-based instead of 1 based index
gRNA.bed[, 2] = as.numeric(gRNA.bed[, 2]) -1
gRNA.bed[, 3] = as.numeric(gRNA.bed[, 3])
gRNA.bed[gRNA.bed[,6] == "+" ,7] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "+" ,2]) +
min(overlap.gRNA.positions) - 1
gRNA.bed[gRNA.bed[,6] == "-" ,7] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "-" ,3]) -
max(overlap.gRNA.positions)
gRNA.bed[gRNA.bed[,6] == "+", 8] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "+", 2]) +
max(overlap.gRNA.positions)
gRNA.bed[gRNA.bed[,6] == "-", 8] <- as.numeric(gRNA.bed[gRNA.bed[,6] == "-", 3]) -
min(overlap.gRNA.positions) + 1
write.table("track name=\"gRNA sites\" description=\"CRISPRseek\" visibility=2 useScore=1 itemRgb=\"On\"", file=bedFile, col.names=FALSE, row.names=FALSE, quote = FALSE)
write.table(gRNA.bed, file=bedFile, sep=" ", row.names=FALSE, col.names=FALSE, append=TRUE, quote = FALSE)
on.target <- unique(cbind(as.character(on.target$name),
as.character(on.target$forViewInUCSC),
as.character(on.target$extendedSequence),
as.character(on.target$gRNAefficacy)
))
colnames(on.target) = c("names", "forViewInUCSC", "extendedSequence", "gRNAefficacy")
if (useEfficacyFromInputSeq)
{
on.target <- as.data.frame(on.target[,1:2])
inputEfficacy <- read.table(efficacyFile, sep="\t", header = TRUE,
stringsAsFactors=FALSE)
inputEfficacy <- as.data.frame(cbind(name = inputEfficacy$name,
extendedSequence = inputEfficacy$extendedSequence,
gRNAefficacy = inputEfficacy$gRNAefficacy))
on.target <- merge(on.target, inputEfficacy, by.x="names", by.y ="name")
}
if(dim(on.target)[1] >0)
summary <- unique(merge(on.target, summary, by="names", all=TRUE))
write.table(summary[order(as.character(summary$names)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
cat("Scan for REsites in flanking region...\n")
if (outputUniqueREs && !missing(BSgenomeName) &&
class(BSgenomeName) == "BSgenome")
{
REs.isUnique100 <- uniqueREs(REcutDetails = REcutDetails,
summary = summary, offTargets$offtargets, scanUpstream = 100,
scanDownstream =100, BSgenomeName = BSgenomeName)
REs.isUnique50 <- uniqueREs(REcutDetails = REcutDetails,
summary = summary, offTargets$offtargets, scanUpstream = 50,
scanDownstream = 50, BSgenomeName = BSgenomeName)
summary <- cbind(summary, uniqREin200 = REs.isUnique100,
uniqREin100 = REs.isUnique50)
summary$uniqREin200 <- as.character(summary$uniqREin200)
summary$uniqREin100 <- as.character(summary$uniqREin100)
}
else
{
REs.isUnique100 = ""
REs.isUnique50 = ""
}
}
else
{
warnings("No on-target found for the input gRNAs with your search criteria!")
gRNA.bed = ""
REs.isUnique100 = ""
REs.isUnique50 = ""
}
if (foldgRNAs)
{
source(system.file("extdata/foldgRNAs.R",package = "CRISPRseek"))
gRNAs.withoutPAM <- substr(as.character(summary$gRNAsPlusPAM), 1, gRNA.size)
folded.gRNAs <- foldgRNAs(gRNAs.withoutPAM, gRNA.backbone = gRNA.backbone,
temperature = temperature)
if (length(dim(folded.gRNAs)) > 0)
{
if (dim(folded.gRNAs)[1] >1)
summary <- cbind(summary, folded.gRNAs[,-1])
else
summary <- data.frame(c(summary, folded.gRNAs[,-1]))
}
}
#write.table(summary[order(as.character(summary$forViewInUCSC)), ],
### even there is no perfect target for a gRNA, it will be kept in the summary file
### need to calculate the topN offtarget score and distance correctly yet if include those gRNAs without target
gRNAs.notInGenome <- setdiff(names(gRNAs), summary$names)
if (length(gRNAs.notInGenome) > 0)
{
dat2 <- data.frame(matrix(nrow = length(gRNAs.notInGenome), ncol = dim(summary)[2]))
colnames(dat2) <- colnames(summary)
dat2$names <- gRNAs.notInGenome
dat2$gRNAsPlusPAM <- paste(substr(as.character(gRNAs[names(gRNAs) %in% gRNAs.notInGenome]), 1, gRNA.size), PAM, sep ="")
summary <- rbind(summary, dat2)
}
if (dim(on.target)[1] == 0)
write.table(summary[order(as.character(summary$names)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
else
write.table(summary[order(as.character(summary$forViewInUCSC)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
if (predIndelFreq) {
if (predictIndelFreq.onTargetOnly)
targets <- unique(subset(offTargets$offtargets,
offTargets$offtargets$n.mismatch == 0 & offTargets$offtargets$isCanonicalPAM ==1))
else
targets <- subset(offTargets$offtargets, offTargets$offtargets$isCanonicalPAM == 1)
if (useBSgenome) {
extendedSequence <- getExtendedSequence(targets,
useBSgenome = TRUE,
BSgenomeName = BSgenomeName,
baseBeforegRNA = baseBeforegRNA.indelFreq,
baseAfterPAM = baseAfterPAM.indelFreq, forMethod = method.indelFreq)
}
else {
extendedSequence <- getExtendedSequence(targets,
useBSgenome = FALSE,
genomeSeq = genomeSeq,
baseBeforegRNA = baseBeforegRNA.indelFreq,
baseAfterPAM = baseAfterPAM.indelFreq, forMethod = method.indelFreq)
}
tryCatch((
indelFreqFS <- predictRelativeFreqIndels(extendedSequence, method = method.indelFreq)
), error = function(e) {print(e); })
if (exists("indelFreqFS"))
{
fs <- unlist(lapply(indelFreqFS, function(x) { x$fs }))
indelFreq <- lapply(indelFreqFS, function(x) {x$indel})
entropy <- unlist(lapply(indelFreq, function(x) {
if (length(x) > 1)
sum(-as.numeric(x[,2])/100 * log(as.numeric(x[,2])/100, base = 450), na.rm = TRUE)
else
NA
}))
fs2 <- data.frame(cbind(names = as.character(targets[,1]), frameshift = fs,
entropy = entropy, n.mismatch = as.character(targets$n.mismatch)))
fs2[,1] <- as.character(fs2[,1])
summary <- data.frame(summary)
summary[,1] <- as.character(summary[,1])
summary <- merge(subset(fs2, fs2[,4] == 0)[,-4], summary, all.y = TRUE)
write.table(summary[order(as.character(summary$forViewInUCSC)), ],
file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
names(indelFreq) <- paste(targets[,1], targets[,2], targets[,3],
sep= ",")
if (!predictIndelFreq.onTargetOnly)
{
targets[,1] <- as.character(targets[,1])
fs2 <- cbind(OffTargetSequence = as.character(targets[,3]), fs2[, -1])
targets <- merge(targets, fs2, all.x = TRUE)
offTargets$offtargets <- targets
write.table(targets, file = paste(outputDir, "OfftargetAnalysis.xls", sep = ""),
sep = "\t", row.names = FALSE)
}
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50,
indelFreq = indelFreq)
}
else
{
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50)
}
}
else {
cat("Done. Please check output files in directory \n", outputDir, "\n")
list(on.target=on.target, summary=summary, offtarget = offTargets$offtargets,
gRNAs.bedFormat=gRNA.bed, REcutDetails = REcutDetails,
REs.isUnique100 = REs.isUnique100, REs.isUnique50 = REs.isUnique50)
}
}
else
{
if (PAM.location == "3prime")
x <- paste(substr(as.character(gRNAs), 1, gRNA.size), PAM, sep ="")
else
x <- paste(PAM, substr(as.character(gRNAs), 1, gRNA.size), sep ="")
summary <- cbind(names = names(gRNAs), gRNAsPlusPAM = x,top5OfftargetTotalScore = rep("NA", length(gRNAs)),
top10OfftargetTotalScore = rep("NA", length(gRNAs)),
top1Hit.onTarget.MMdistance2PAM = rep("NA", length(gRNAs))
)
write.table(summary, file = paste(outputDir, "Summary.xls", sep = ""),
sep = "\t", row.names = FALSE)
summary
}
}
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.