View source: R/chipseqCounts.R
chipseqCounts | R Documentation |
This function executes a set of docker containers allowing the detection of TFs and Histon marks peaks. #params skewer
chipseqCounts(
group = c("sudo", "docker"),
output.folder = getwd(),
mock.folder,
test.folder,
scratch.folder,
adapter5 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
adapter3 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
threads = 8,
seq.type = "se",
min.length = 30,
genome.folder,
mock.id = "igg",
test.id = "tf",
genome,
read.size = 50,
tool = "macs",
macs.min.mfold = 10,
macs.max.mfold = 30,
macs.pval = "1e-5",
sicer.wsize = 200,
sicer.gsize = 200,
sicer.fdr = 0.1,
tss.distance = 0,
max.upstream.distance = 10000,
remove.duplicates = "N"
)
group, |
a character string. Two options: |
output.folder, |
a character string indicating where final results will be saved |
mock.folder, |
a character string indicating where gzip fastq file for unspecific ChIP is located |
test.folder, |
a character string indicating where gzip fastq file for specific ChIP is located |
scratch.folder, |
a character string indicating the scratch folder where docker container will be mounted |
adapter5, |
a character string indicating the fwd adapter |
adapter3, |
a character string indicating the rev adapter |
threads, |
a number indicating the number of cores to be used from the application |
seq.type, |
a character string indicating the type of reads to be trimmed. One options: |
min.length, |
a number indicating minimal length required to return a trimmed read |
genome.folder, |
a character string indicating the folder where the indexed reference genome is located |
mock.id, |
a character string indicating the unique id to be associated to the mock bam that will be created |
test.id, |
a character string indicating the unique id to be associated to the test bam that will be created |
genome, |
a character string indicating the genome used as reference for data generation. Available options: hg19, hg38, mm9, mm10 |
read.size, |
an integer indicating the length of the sequenced reads |
tool, |
a character string indicating the peaks calling algorith. Available options: macs and sicer. Macs, v 1.14, is used to call TF peaks, as instead sicer, v 1.1, is used to call histone mark peaks |
macs.min.mfold, |
an integer indicating the minimum enrichment ratio against background |
macs.max.mfold, |
an integer indicating the maximum enrichment ratio against background |
macs.pval, |
a character string, indicationg the pvalue cutoff to be used to filter peaks with low statistical significance.The number must be provided in scientific notation as the default value shows |
sicer.wsize, |
an integer indicating the windows size to be used by sicer |
sicer.gsize, |
an integer indicating the gap size to be used by sicer. Suggested values: H3K4Me3=200; H3K27Me3=600 |
sicer.fdr, |
an integer indicating the pvalue cutoff to be used to filter peaks with low statistical significance |
tss.distance, |
an integer indicating the distance of TSS with respect to gene start |
max.upstream.distance, |
an integer indicating the maximum distance to associate a gene ID to a peak |
remove.duplicates, |
a character string indicating if duplicated reads have to be removed. Available options: Y, to remove douplicates, N to keep duplicates |
Returns the output of skewer, bwa, chipseq
Raffaele Calogero
## Not run:
system("wget 130.192.119.59/public/test.chipseqCounts.zip")
unzip("test.chipseqCounts.zip")
setwd("test.chipseqCounts")
library(docker4seq)
chipseqCounts(group = "docker", output.folder = "/data/tests/chipseqCounts/test.chipseqCounts/prdm51.igg",
mock.folder="/data/tests/chipseqCounts/test.chipseqCounts/igg",
test.folder="/data/tests/chipseqCounts/test.chipseqCounts/prdm51", scratch.folder="/data/scratch/",
adapter5 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
adapter3 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
threads = 8, min.length = 30, genome.folder="/data/genomes/mm10bwa",
mock.id = "igg", test.id = "tf", genome="mm10", read.size = 50,
tool = "macs", macs.min.mfold = 10, macs.max.mfold = 30,
macs.pval = "1e-5", sicer.wsize = 200, sicer.gsize = 200,
sicer.fdr = 0.1, tss.distance = 0, max.upstream.distance = 10000,
remove.duplicates = "N")
## End(Not run)
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.