chipseqCounts: Running MACS & SICER workflow NOT READY FOR STABLE check it!

In kendomaniac/docker4seq: Running NGS computing demanding applications, e.g reads mapping and counting, wrapped in docker containers

Running MACS & SICER workflow NOT READY FOR STABLE check it!

Description

This function executes a set of docker containers allowing the detection of TFs and Histon marks peaks. #params skewer

Usage

chipseqCounts(
  group = c("sudo", "docker"),
  output.folder = getwd(),
  mock.folder,
  test.folder,
  scratch.folder,
  adapter5 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
  adapter3 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
  threads = 8,
  seq.type = "se",
  min.length = 30,
  genome.folder,
  mock.id = "igg",
  test.id = "tf",
  genome,
  read.size = 50,
  tool = "macs",
  macs.min.mfold = 10,
  macs.max.mfold = 30,
  macs.pval = "1e-5",
  sicer.wsize = 200,
  sicer.gsize = 200,
  sicer.fdr = 0.1,
  tss.distance = 0,
  max.upstream.distance = 10000,
  remove.duplicates = "N"
)

Arguments

group	a character string. Two options: "sudo" or "docker", depending to which group the user belongs
output.folder	a character string indicating where final results will be saved
mock.folder	a character string indicating where gzip fastq file for unspecific ChIP is located
test.folder	a character string indicating where gzip fastq file for specific ChIP is located
scratch.folder	a character string indicating the scratch folder where docker container will be mounted
adapter5	a character string indicating the fwd adapter
adapter3	a character string indicating the rev adapter
threads	a number indicating the number of cores to be used from the application
seq.type	a character string indicating the type of reads to be trimmed. One options: "se" for single end sequencing
min.length	a number indicating minimal length required to return a trimmed read
genome.folder	a character string indicating the folder where the indexed reference genome is located
mock.id	a character string indicating the unique id to be associated to the mock bam that will be created
test.id	a character string indicating the unique id to be associated to the test bam that will be created
genome	a character string indicating the genome used as reference for data generation. Available options: hg19, hg38, mm9, mm10
read.size	an integer indicating the length of the sequenced reads
tool	a character string indicating the peaks calling algorith. Available options: macs and sicer. Macs, v 1.14, is used to call TF peaks, as instead sicer, v 1.1, is used to call histone mark peaks
macs.min.mfold	an integer indicating the minimum enrichment ratio against background
macs.max.mfold	an integer indicating the maximum enrichment ratio against background
macs.pval	a character string, indicationg the pvalue cutoff to be used to filter peaks with low statistical significance.The number must be provided in scientific notation as the default value shows
sicer.wsize	an integer indicating the windows size to be used by sicer
sicer.gsize	an integer indicating the gap size to be used by sicer. Suggested values: H3K4Me3=200; H3K27Me3=600
sicer.fdr	an integer indicating the pvalue cutoff to be used to filter peaks with low statistical significance
tss.distance	an integer indicating the distance of TSS with respect to gene start
max.upstream.distance	an integer indicating the maximum distance to associate a gene ID to a peak
remove.duplicates	a character string indicating if duplicated reads have to be removed. Available options: Y, to remove douplicates, N to keep duplicates

Value

Returns the output of skewer, bwa, chipseq

Author(s)

Raffaele Calogero

Examples

## Not run: 
system("wget 130.192.119.59/public/test.chipseqCounts.zip")
unzip("test.chipseqCounts.zip")
setwd("test.chipseqCounts")
library(docker4seq)
chipseqCounts(group = "docker", output.folder = "/data/tests/chipseqCounts/test.chipseqCounts/prdm51.igg",
             mock.folder="/data/tests/chipseqCounts/test.chipseqCounts/igg",
             test.folder="/data/tests/chipseqCounts/test.chipseqCounts/prdm51", scratch.folder="/data/scratch/",
             adapter5 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
             adapter3 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
             threads = 8, min.length = 30, genome.folder="/data/genomes/mm10bwa",
             mock.id = "igg", test.id = "tf", genome="mm10", read.size = 50,
             tool = "macs", macs.min.mfold = 10, macs.max.mfold = 30,
             macs.pval = "1e-5", sicer.wsize = 200, sicer.gsize = 200,
             sicer.fdr = 0.1, tss.distance = 0, max.upstream.distance = 10000,
             remove.duplicates = "N")

## End(Not run)

kendomaniac/docker4seq documentation built on Sept. 3, 2024, 6:42 p.m.