rnaseqCounts: Running RNAseq counting workflow for a single sample

In kendomaniac/docker4seq: Running NGS computing demanding applications, e.g reads mapping and counting, wrapped in docker containers

Running RNAseq counting workflow for a single sample

Description

This function executes a set of docker containers allowing the generation of gene and isoforms counts for a single sample. #params skewer

Usage

rnaseqCounts(
  group = "sudo",
  fastq.folder = getwd(),
  scratch.folder = "/data/scratch",
  threads = 4,
  adapter5,
  adapter3,
  seq.type = "pe",
  min.length = 40,
  genome.folder = "/data/genomes/hg38star",
  strandness = "none",
  save.bam = TRUE,
  org = "hg38",
  annotation.type = "gtfENSEMBL"
)

Arguments

group	a character string. Two options: "sudo" or "docker", depending to which group the user belongs
fastq.folder	a character string indicating where gzip fastq files are located
scratch.folder	a character string indicating the scratch folder where docker container will be mounted
threads	a number indicating the number of cores to be used from the application
adapter5	a character string indicating the fwd adapter
adapter3	a character string indicating the rev adapter
seq.type	a character string indicating the type of reads to be generated by the sequencer. Two options: "se" or "pe" respectively for single end and pair end sequencing.
min.length	a number indicating minimal length required to return a trimmed read #params rsemstar
genome.folder	a character string indicating the folder where the indexed reference genome is located. IMPORTANT the present function only suport genomic indexes made using ensembl genom and the corresponding gtf
strandness	a character string indicating the type ofsequencing protocol used for the analysis. Three options: "none", "forward", "reverse" respectively for non strand selection, reverse for Illumina strandness protocols, reverse for ACCESS Illumina protocol
save.bam	a boolean value, TRUE or FALSE, to save also BAM files generated by STAR and RSEM #params rsemanno
org	a character string indicating the genome assembly used for mapping and counting with "rsemstar" function only required for biocENSEMBL based annotation
annotation.type	a character string. Two options: "biocENSEMBL" or "gtfENSEMBL". "biocENSEMBL" will annotate by Bioconductor only protein coding genes. "gtfENSEMBL" will annotate all RNAs described in "annotation.type"

Value

Returns the output of skewer, rsemstar, rsemannos' functions

Author(s)

Raffaele Calogero

Examples

## Not run: 
system("wget http://130.192.119.59/public/test_R1.fastq.gz")
library(docker4seq)
rnaseqCounts(group="docker",fastq.folder=getwd(), scratch.folder="/data/scratch/",
            adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
            adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
            seq.type="se", threads=24,  min.length=40,
            genome.folder="/data/genomes/hg38star", strandness="none", save.bam=FALSE,
            org="hg38", annotation.type="gtfENSEMBL")

## End(Not run)

kendomaniac/docker4seq documentation built on Sept. 3, 2024, 6:42 p.m.