tRap-package: compute transcription factor binding site affinity

In matthuska/tRap: A biophysical model for transcription factor binding affinities

Description

The TRAP method to predict transcription factor binding affinity to DNA sequences (Roider et al 2007)

References

Roider, H. G.; Kanhere, A.; Manke, T. & Vingron, M. Predicting transcription factor affinities to DNA from a biophysical model. Bioinformatics, 2007, 23, 134-141

Examples

pwm = matrix(c(5, 4, 3, 1, 10, 12, 5, 3, 3, 5, 3, 10), nrow=4)
seq = "ACTGACGTGTGCACACGATGCTAGCTG"
affinity(pwm, seq)

matthuska/tRap documentation built on May 21, 2019, 1:23 p.m.