cutadapt: cutadapt

In omicsCore/SEQprocess: SEQprocess : a modularized and customizable pipeline framework for NGS processing in R package.

Description

A wrapper function to run Cutadapt

Usage

cutadpat(fq1, output.dir, adpat.seq="TGGAATTCTCGGGTGCCAAGG", m=1, mc.cores=1, run.cmd=TRUE)

Arguments

fq1	Path to fastq files
output.dir	Output directory
adapt.seq	A parameter value for -b in cutadapt. Adapter sequences user wants to remove
m	A parameter value for -m in cutadapt. Discards processed reads that are shorter than m option. Reads that are too short before adapter removal are also discarded.
run.cmd	Whether to execute the command line (default=TRUE)
mc.cores	The number of cores to use. Must be at least one(default=1), and parallelization requires at least two cores.

Details

Cutadapt finds and removes adapter sequences, primers, poly-A tails and other types of unwanted sequence.

References

Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads

See Also

https://cutadapt.readthedocs.io/en/stable/

omicsCore/SEQprocess documentation built on May 7, 2020, 4:18 a.m.