bin_file: Bins a given FASTA file and outputs each bin as a seperate...
In philliplab/MotifBinner: Bin reads by Motif

Bins a given FASTA file and outputs each bin as a seperate file

  bin_file(file_name = "~/projects/MotifBinner/data/CAP177_2040_v1merged.fastq",
  add_uniq_id = TRUE, number_of_front_bases_to_discard = 28,
  prefix = "CCAGCTGGTTATGCGATTCTMARGTG", suffix = "CTGAGCGTGTGGCAAGGCCC",
  motif_length = 9, max.mismatch = 5, fixed = FALSE,
  write_files = FALSE)

`file_name`	The file name
`add_uniq_id`	If True, an integer will be appended to the end of each sequence's name so that all identical sequences in a bin gets the same number and sequences who are not identical will get different numbers.
`number_of_front_bases_to_discard`	The number of bases to remove from the front of the sequence. The first few bases are part of the primer sequence and needs to be trimmed off since they do not contain any extra information. This varies between sequencing approaches, so the parameter should be set with knowledge of the process. The primer can contain degeneracies, so its better to chop it off earlier rather than later.
`prefix`	See ?extract_motifs
`suffix`	See ?extract_motifs
`motif_length`	See ?extract_motifs
`max.mismatch`	See ?extract_motifs
`fixed`	See ?extract_motifs
`write_files`	If this is a directory, the bins will be written to that folder as FASTA files.