Description Usage Arguments Examples
TOPO reaction and LR reaction
1 2 3 4 5 6 7 8 9 | get_pentr(pentr)
dstr_gw_topo(insert, pentr)
dstr_gw_lr(entry, distination, distination_to_lower = TRUE)
dstr_gw_lr_both(entry, distination)
dstr_gw_topo_lr(insert, distination, pentr)
|
pentr |
optional. pENTR D-TOPO sequence or the fasta file path |
insert |
insert sequence. without 5'CACC |
entry |
Entry clone |
distination |
Distination vector |
distination_to_lower |
change distination vector to lower case |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 | dstr_gw_topo("atgatgatgtga")
attR1 <- "ACAAGTTTGTACAAAAAAGCTGAAC"
attR2 <- "GTTCAGCTTTCTTGTACAAAGTGGT"
A9 <- "AAAAAAAAA"
dummy <- paste0(A9, attR1, A9, attR2, A9, collapse = "")
dummy2 <- dstr_rev_comp(dummy)
dummy3 <- paste0(dummy, dummy2, collapse = "")
test_distination <- dstr(c(dummy, dummy2, dummy3), paste0("dummy", 1:3))
test_distination
dstr_gw_topo("atgtga") %>%
dstr_gw_lr(test_distination) %>%
write_fasta()
dstr_gw_topo("atgtga") %>%
dstr_gw_lr_both(test_distination) %>%
write_fasta()
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.