CellBarcode is an R package for dealing with Cellular DNA barcoding sequencing data.
The R package were created by Wenjie SUN, Anne-Marie Lyne, and Leïla Perié at Institut Curie.
CellBarcode can handle all kinds of DNA barcodes, as long as:
Performs quality control for the DNA sequence results, and filters the sequences according to their quality metrics.
Identifies barcode (and UMI) information in sequencing results.
Performs quality control and deals with the spurious sequence which comes from potential PCR & sequence errors.
Provides toolkits to make it easier to manipulate samples and barcodes with metadata.
if(!requireNamespace("remotes", quietly = TRUE))
install.packages("remotes")
remotes::install_github("wenjie1991/CellBarcode")
Here is an example of a basic workflow:
library(CellBarcode)
library(magrittr)
# The example data is a mix of MEF lines with known barcodes
# 2000 reads for each file have been sampled for this test dataset
# TODO: Citation of the paper:
example_data <- system.file("extdata", "mef_test_data", package = "CellBarcode")
fq_files <- dir(example_data, "gz", full=TRUE)
# prepare metadata
metadata <- stringr::str_split_fixed(basename(fq_files), "_", 10)[, c(4, 6)]
metadata <- data.frame(metadata)
sample_name <- apply(metadata, 1, paste, collapse = "_")
colnames(metadata) = c("cell_number", "replication")
rownames(metadata) = sample_name
metadata
# extract UMI barcode with regular expression
bc_obj <- bc_extract(
fq_files,
pattern = "(.{12})CTCGAGGTCATCGAAGTATCAAG(.+)TAGCAAGCTCGAGAGTAGACCTACT",
pattern_type = c("UMI" = 1, "barcode" = 2),
sample_name = sample_name,
metadata = metadata
)
bc_obj
# sample subset operation, select 'mixa'
bc_sub <- bc_subset(bc_obj, sample=replication == "mixa")
bc_sub
# filter the barcode, UMI barcode amplicon >= 2 & UMI counts >= 2
bc_sub <- bc_cure_umi(bc_sub, depth = 2) %>% bc_cure_depth(depth = 2)
# select barcodes with a white list
bc_sub[c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"), ]
# export the barcode counts to data.frame
head(bc_2df(bc_sub))
# export the barcode counts to matrix
head(bc_2matrix(bc_sub))
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.