bc_cure_depth: Filters barcodes by counts

In wenjie1991/CellBarocde: Cellular DNA Barcode Analysis toolkit

Description

bc_cure_depth filters barcodes by the read counts or the UMI counts.

Usage

bc_cure_depth(barcodeObj, depth = 0, isUpdate = TRUE)

## S4 method for signature 'BarcodeObj'
bc_cure_depth(barcodeObj, depth = 0, isUpdate = TRUE)

Arguments

barcodeObj	A BarcodeObj object.
depth	A numeric or a vector of numeric, specifying the threshold of minimum count for a barcode to kept. If the input is a vector, if the vector length is not the same to the sample number the element will be repeatedly used. And when the depth argument is a number with negative value, automatic cutoff point will be chosen by bc_auto_cutoff function for each samples. See bc_auto_cutoff for details.
isUpdate	A logical value. If TRUE, the cleanBc slot in BarcodeObj will be used preferentially, otherwise the messyBc slot will be used. If no cleanBc is available, messyBc will be used instead.

Value

A BarcodeObj object with cleanBc slot updated or created.

Examples

data(bc_obj)

d1 <- data.frame(
    seq = c(
        "ACTTCGATCGATCGAAAAGATCGATCGATC",
        "AATTCGATCGATCGAAGAGATCGATCGATC",
        "CCTTCGATCGATCGAAGAAGATCGATCGATC",
        "TTTTCGATCGATCGAAAAGATCGATCGATC",
        "AAATCGATCGATCGAAGAGATCGATCGATC",
        "CCCTCGATCGATCGAAGAAGATCGATCGATC",
        "GGGTCGATCGATCGAAAAGATCGATCGATC",
        "GGATCGATCGATCGAAGAGATCGATCGATC",
        "ACTTCGATCGATCGAACAAGATCGATCGATC",
        "GGTTCGATCGATCGACGAGATCGATCGATC",
        "GCGTCCATCGATCGAAGAAGATCGATCGATC"
        ),
    freq = c(
        30, 60, 9, 10, 14, 5, 10, 30, 6, 4 , 6
        )
    )

pattern <- "([ACTG]{3})TCGATCGATCGA([ACTG]+)ATCGATCGATC"
bc_obj <- bc_extract(list(test = d1), pattern, sample_name=c("test"),
    pattern_type=c(UMI=1, barcode=2))

# Remove barcodes with depth < 5
(bc_cured <- bc_cure_depth(bc_obj, depth=5))
bc_2matrix(bc_cured)

# Use UMI information, filter the barcode < 5 UMI
bc_umi_cured <- bc_cure_umi(bc_obj, depth =0, doFish=TRUE, isUniqueUMI=TRUE)
bc_cure_depth(bc_umi_cured, depth = 5)

###

wenjie1991/CellBarocde documentation built on Dec. 23, 2021, 5:11 p.m.