Description Usage Arguments Value Examples
C++ implementation of Motif Enrichment calculation
1 2 3 4 5 6 7 8 9 | calculate_transcript_mc(
absoluteHits,
totalSites,
relHitsForeground,
n,
maxPermutations,
minPermutations,
e
)
|
absoluteHits |
number of putative binding sites per sequence
(returned by |
totalSites |
number of potential binding sites per sequence
(returned by |
relHitsForeground |
relative number of hits in foreground set |
n |
number of sequences in the foreground set |
maxPermutations |
maximum number of foreground permutations performed in Monte Carlo test for enrichment score |
minPermutations |
minimum number of foreground permutations performed in Monte Carlo test for enrichment score |
e |
stop criterion for enrichment score Monte Carlo test:
aborting permutation process
after observing |
list with p-value and number of iterations of Monte Carlo sampling for foreground enrichment
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 | foreground_seqs <- c("CAGUCAAGACUCC", "AAUUGGUUGUGGGGCUUCCCUGUACAU",
"AGAU", "CCAGUAA", "UGUGGGG")
background_seqs <- c(foreground_seqs, "CAACAGCCUUAAUU", "CUUUGGGGAAU",
"UCAUUUUAUUAAA", "AUCAAAUUA", "GACACUUAAAGAUCCU",
"UAGCAUUAACUUAAUG", "AUGGA", "GAAGAGUGCUCA",
"AUAGAC", "AGUUC")
motif_db <- get_motif_by_id("M178_0.6")
fg <- score_transcripts(foreground_seqs, cache = FALSE,
motifs = motif_db)
bg <- score_transcripts(background_seqs, cache = FALSE,
motifs = motif_db)
mc_result <- calculate_transcript_mc(unlist(bg$absolute_hits),
unlist(bg$total_sites),
fg$df$absolute_hits / fg$df$total_sites,
length(foreground_seqs), 1000, 500, 5)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.