score_transcripts: Scores transcripts with position weight matrices

In transite: RNA-binding protein motif analysis

Description

This function is used to count the binding sites in a set of sequences for all or a subset of RNA-binding protein sequence motifs and returns the result in a data frame, which is subsequently used by calculate_motif_enrichment to obtain binding site enrichment scores.

Usage

score_transcripts(
  sequences,
  motifs = NULL,
  max_hits = 5,
  threshold_method = c("p_value", "relative"),
  threshold_value = 0.25^6,
  n_cores = 1,
  cache = paste0(tempdir(), "/sc/")
)

Arguments

sequences	character vector of named sequences (only containing upper case characters A, C, G, T), where the names are RefSeq identifiers and sequence type qualifiers ("3UTR", "5UTR", "mRNA"), e.g. "NM_010356|3UTR"
motifs	a list of motifs that is used to score the specified sequences. If is.null(motifs) then all Transite motifs are used.
max_hits	maximum number of putative binding sites per mRNA that are counted
threshold_method	either "p_value" (default) or "relative". If threshold_method equals "p_value", the default threshold_value is 0.25^6, which is lowest p-value that can be achieved by hexamer motifs, the shortest supported motifs. If threshold_method equals "relative", the default threshold_value is 0.9, which is 90% of the maximum PWM score.
threshold_value	semantics of the threshold_value depend on threshold_method (default is 0.25^6)
n_cores	the number of cores that are used
cache	either logical or path to a directory where scores are cached. The scores of each motif are stored in a separate file that contains a hash table with RefSeq identifiers and sequence type qualifiers as keys and the number of putative binding sites as values. If cache is FALSE, scores will not be cached.

Value

A list with three entries:

(1) df: a data frame with the following columns:

motif_id	the motif identifier that is used in the original motif library
motif_rbps	the gene symbol of the RNA-binding protein(s)
absolute_hits	the absolute frequency of putative binding sites per motif in all transcripts
relative_hits	the relative, i.e., absolute divided by total, frequency of binding sites per motif in all transcripts
total_sites	the total number of potential binding sites
one_hit, two_hits, ...	number of transcripts with one, two, three, ... putative binding sites

(2) total_sites: a numeric vector with the total number of potential binding sites per transcript

(3) absolute_hits: a numeric vector with the absolute (not relative) number of putative binding sites per transcript

See Also

Other matrix functions: calculate_motif_enrichment(), run_matrix_spma(), run_matrix_tsma(), score_transcripts_single_motif()

Examples

foreground_set <- c(
  "CAACAGCCUUAAUU", "CAGUCAAGACUCC", "CUUUGGGGAAU",
  "UCAUUUUAUUAAA", "AAUUGGUGUCUGGAUACUUCCCUGUACAU",
  "AUCAAAUUA", "AGAU", "GACACUUAAAGAUCCU",
  "UAGCAUUAACUUAAUG", "AUGGA", "GAAGAGUGCUCA",
  "AUAGAC", "AGUUC", "CCAGUAA"
)
# names are used as keys in the hash table (cached version only)
# ideally sequence identifiers (e.g., RefSeq ids) and region labels
# (e.g., 3UTR for 3'-UTR)
names(foreground_set) <- c(
  "NM_1_DUMMY|3UTR", "NM_2_DUMMY|3UTR", "NM_3_DUMMY|3UTR",
  "NM_4_DUMMY|3UTR", "NM_5_DUMMY|3UTR", "NM_6_DUMMY|3UTR",
  "NM_7_DUMMY|3UTR", "NM_8_DUMMY|3UTR", "NM_9_DUMMY|3UTR",
  "NM_10_DUMMY|3UTR", "NM_11_DUMMY|3UTR", "NM_12_DUMMY|3UTR",
  "NM_13_DUMMY|3UTR", "NM_14_DUMMY|3UTR"
)

# specific motifs, uncached
motifs <- get_motif_by_rbp("ELAVL1")
scores <- score_transcripts(foreground_set, motifs = motifs, cache = FALSE)
## Not run: 
# all Transite motifs, cached (writes scores to disk)
scores <- score_transcripts(foreground_set)

# all Transite motifs, uncached
scores <- score_transcripts(foreground_set, cache = FALSE)

foreground_df <- transite:::ge$foreground1_df
foreground_set <- foreground_df$seq
names(foreground_set) <- paste0(foreground_df$refseq, "|",
   foreground_df$seq_type)
scores <- score_transcripts(foreground_set)

## End(Not run)

transite documentation built on Nov. 8, 2020, 5:27 p.m.