junctionAlignment: Calculate junction region alignment properties

In alakazam: Immunoglobulin Clonal Lineage and Diversity Analysis

Calculate junction region alignment properties

Description

junctionAlignment determines the number of deleted germline nucleotides in the junction region and the number of V gene and J gene nucleotides in the CDR3.

Usage

junctionAlignment(
  data,
  germline_db,
  v_call = "v_call",
  d_call = "d_call",
  j_call = "j_call",
  v_germline_start = "v_germline_start",
  v_germline_end = "v_germline_end",
  d_germline_start = "d_germline_start",
  d_germline_end = "d_germline_end",
  j_germline_start = "j_germline_start",
  j_germline_end = "j_germline_end",
  np1_length = "np1_length",
  np2_length = "np2_length",
  junction = "junction",
  junction_length = "junction_length",
  sequence_alignment = "sequence_alignment"
)

Arguments

data	data.frame containing sequence data.
germline_db	reference germline database for the V, D and J genes. in data
v_call	V gene assignment column.
d_call	D gene assignment column.
j_call	J gene assignment column.
v_germline_start	column containing the start position of the alignment in the V reference germline.
v_germline_end	column containing the end position of the alignment in the V reference germline.
d_germline_start	column containing the start position of the alignment in the D reference germline.
d_germline_end	column containing the start position of the alignment in the D reference germline.
j_germline_start	column containing the start position of the alignment in the J reference germline.
j_germline_end	column containing the start position of the alignment in the J reference germline.
np1_length	combined length of the N and P regions between the V and D regions (heavy chain) or V and J regions (light chain).
np2_length	combined length of the N and P regions between the D and J regions (heavy chain).
junction	column containing the junction sequence.
junction_length	column containing the length of the junction region in nucleotides.
sequence_alignment	column containing the aligned sequence.

Value

A modified input data.frame with the following additional columns storing junction alignment information:

1. e3v_length: number of 3' V germline nucleotides deleted.

2. e5d_length: number of 5' D germline nucleotides deleted.

3. e3d_length: number of 3' D germline nucleotides deleted.

4. e5j_length: number of 5' J germline nucleotides deleted.

5. v_cdr3_length: number of sequence_alignment V nucleotides in the CDR3.

6. j_cdr3_length: number of sequence_alignment J nucleotides in the CDR3.

Examples

germline_db <- list(
"IGHV3-11*05"="CAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACT
CTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAG
GGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG
...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGA
CACGGCCGTGTATTACTGTGCGAGAGA",
"IGHD3-10*01"="GTATTACTATGGTTCGGGGAGTTATTATAAC",
"IGHJ5*02"="ACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG"
)

db <- junctionAlignment(SingleDb, germline_db)

alakazam documentation built on Sept. 30, 2023, 9:07 a.m.