Nothing
# Common DNA, amino acid, and gene annotation operations for Alakazam
#### Distance functions ####
#' Build a DNA distance matrix
#'
#' \code{getDNAMatrix} returns a Hamming distance matrix for IUPAC ambiguous
#' DNA characters with modifications for gap, \code{c("-", ".")}, and missing,
#' \code{c("?")}, character values.
#'
#' @param gap value to assign to characters in the set \code{c("-", ".")}.
#'
#' @return A \code{matrix} of DNA character distances with row and column names
#' indicating the character pair. By default, distances will be either 0
#' (equivalent), 1 (non-equivalent or missing), or -1 (gap).
#'
#' @seealso Creates DNA distance matrix for \link{seqDist}.
#' See \link{getAAMatrix} for amino acid distances.
#'
#' @examples
#' # Set gap characters to Inf distance
#' # Distinguishes gaps from Ns
#' getDNAMatrix()
#'
#' # Set gap characters to 0 distance
#' # Makes gap characters equivalent to Ns
#' getDNAMatrix(gap=0)
#'
#' @export
getDNAMatrix <- function(gap=-1) {
# Define Hamming distance matrix
sub_mat <- diag(18)
colnames(sub_mat) <- rownames(sub_mat) <- c(names(IUPAC_DNA), c("-", ".", "?"))
for (i in 1:length(IUPAC_DNA)) {
for (j in i:length(IUPAC_DNA)) {
sub_mat[i, j] <- sub_mat[j, i] <- any(IUPAC_DNA[[i]] %in% IUPAC_DNA[[j]])
}
}
# Add gap characters
sub_mat[c("-", "."), c("-", ".")] <- 1
sub_mat[c("-", "."), 1:15] <- 1 - gap
sub_mat[1:15, c("-", ".")] <- 1 - gap
return(1 - sub_mat)
}
#' Build an AA distance matrix
#'
#' \code{getAAMatrix} returns a Hamming distance matrix for IUPAC ambiguous
#' amino acid characters.
#'
#' @param gap value to assign to characters in the set \code{c("-", ".")}.
#'
#' @return A \code{matrix} of amino acid character distances with row and column names
#' indicating the character pair.
#'
#' @seealso Creates an amino acid distance matrix for \link{seqDist}.
#' See \link{getDNAMatrix} for nucleotide distances.
#'
#' @examples
#' getAAMatrix()
#'
#' @export
getAAMatrix <- function(gap=0) {
# Define Hamming distance matrix
sub_mat <- diag(27)
colnames(sub_mat) <- rownames(sub_mat) <- c(names(IUPAC_AA), c("-", "."))
for (i in 1:length(IUPAC_AA)) {
for (j in i:length(IUPAC_AA)) {
sub_mat[i, j] <- sub_mat[j, i] <- any(IUPAC_AA[[i]] %in% IUPAC_AA[[j]])
}
}
# Add gap characters
sub_mat[c("-", "."), c("-", ".")] <- 1
sub_mat[c("-", "."), c(1:27)] <- 1 - gap
sub_mat[c(1:27), c("-", ".")] <- 1 - gap
return(1 - sub_mat)
}
#' Remove duplicate DNA sequences and combine annotations
#'
#' \code{collapseDuplicates} identifies duplicate DNA sequences, allowing for ambiguous
#' characters, removes the duplicate entries, and combines any associated annotations.
#'
#' @param data data.frame containing Change-O columns. The data.frame
#' must contain, at a minimum, a unique identifier column
#' and a column containing a character vector of DNA sequences.
#' @param id name of the column containing sequence identifiers.
#' @param seq name of the column containing DNA sequences.
#' @param text_fields character vector of textual columns to collapse. The textual
#' annotations of duplicate sequences will be merged into a single
#' string with each unique value alphabetized and delimited by
#' \code{sep}.
#' @param num_fields vector of numeric columns to collapse. The numeric annotations
#' of duplicate sequences will be summed.
#' @param seq_fields vector of nucleotide sequence columns to collapse. The sequence
#' with the fewest number of non-informative characters will be
#' retained. Where a non-informative character is one of
#' \code{c("N", "-", ".", "?")}. Note, this is distinct from the
#' \code{seq} parameter which is used to determine duplicates.
#' @param add_count if \code{TRUE} add the column \code{collpase_count} that
#' indicates the number of sequences that were collapsed to build
#' each unique entry.
#' @param ignore vector of characters to ignore when testing for equality.
#' @param sep character to use for delimiting collapsed annotations in the
#' \code{text_fields} columns. Defines both the input and output
#' delimiter.
#' @param dry if \code{TRUE} perform dry run. Only labels the sequences without
#' collapsing them.
#' @param verbose if \code{TRUE} report the number input, discarded and output
#' sequences; if \code{FALSE} process sequences silently.
#'
#' @return A modified \code{data} data.frame with duplicate sequences removed and
#' annotation fields collapsed if \code{dry=FALSE}. If \code{dry=TRUE},
#' sequences will be labeled with the collapse action, but the input will be
#' otherwise unmodified (see Details).
#'
#' @details
#' \code{collapseDuplicates} identifies duplicate sequences in the \code{seq} column by
#' testing for character identity, with consideration of IUPAC ambiguous nucleotide codes.
#' A cluster of sequences are considered duplicates if they are all equivalent, and no
#' member of the cluster is equivalent to a sequence in a different cluster.
#'
#' Textual annotations, specified by \code{text_fields}, are collapsed by taking the unique
#' set of values within in each duplicate cluster and delimiting those values by \code{sep}.
#' Numeric annotations, specified by \code{num_fields}, are collapsed by summing all values
#' in the duplicate cluster. Sequence annotations, specified by \code{seq_fields}, are
#' collapsed by retaining the first sequence with the fewest number of N characters.
#'
#' Columns that are not specified in either \code{text_fields}, \code{num_fields}, or
#' \code{seq_fields} will be retained, but the value will be chosen from a random entry
#' amongst all sequences in a cluster of duplicates.
#'
#' An ambiguous sequence is one that can be assigned to two different clusters, wherein
#' the ambiguous sequence is equivalent to two sequences which are themselves
#' non-equivalent. Ambiguous sequences arise due to ambiguous characters at positions that
#' vary across sequences, and are discarded along with their annotations when \code{dry=FALSE}.
#' Thus, ambiguous sequences are removed as duplicates of some sequence, but do not create a potential
#' false-positive annotation merger. Ambiguous sequences are not included in the
#' \code{collapse_count} annotation that is added when \code{add_count=TRUE}.
#'
#' If \code{dry=TRUE} sequences will not be removed from the input. Instead, the following columns
#' will be appended to the input defining the collapse action that would have been performed in the
#' \code{dry=FALSE} case.
#'
#' \itemize{
#' \item \code{collapse_id}: an identifier for the group of identical sequences.
#' \item \code{collapse_class}: string defining how the sequence matches to the other in the set.
#' one of \code{"duplicated"} (has duplicates),
#' \code{"unique"} (no duplicates), \code{"ambiguous_duplicate"}
#' (no duplicates after ambiguous sequences are removed),
#' or \code{"ambiguous"} (matches multiple non-duplicate sequences).
#' \item \code{collapse_pass}: \code{TRUE} for the sequences that would be retained.
#' }
#'
#' @seealso Equality is tested with \link{seqEqual} and \link{pairwiseEqual}.
#' For IUPAC ambiguous character codes see \link{IUPAC_DNA}.
#'
#' @examples
#' # Example data.frame
#' db <- data.frame(sequence_id=LETTERS[1:4],
#' sequence_alignment=c("CCCCTGGG", "CCCCTGGN", "NAACTGGN", "NNNCTGNN"),
#' c_call=c("IGHM", "IGHG", "IGHG", "IGHA"),
#' sample_id=c("S1", "S1", "S2", "S2"),
#' duplicate_count=1:4,
#' stringsAsFactors=FALSE)
#'
#' # Annotations are not parsed if neither text_fields nor num_fields is specified
#' # The retained sequence annotations will be random
#' collapseDuplicates(db, verbose=TRUE)
#'
#' # Unique text_fields annotations are combined into a single string with ","
#' # num_fields annotations are summed
#' # Ambiguous duplicates are discarded
#' collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
#' verbose=TRUE)
#'
#' # Use alternate delimiter for collapsing textual annotations
#' collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
#' sep="/", verbose=TRUE)
#'
#' # Add count of duplicates
#' collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
#' add_count=TRUE, verbose=TRUE)
#'
#' # Masking ragged ends may impact duplicate removal
#' db$sequence_alignment <- maskSeqEnds(db$sequence_alignment)
#' collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
#' add_count=TRUE, verbose=TRUE)
#'
#' @export
collapseDuplicates <- function(data, id="sequence_id", seq="sequence_alignment",
text_fields=NULL, num_fields=NULL, seq_fields=NULL,
add_count=FALSE, ignore=c("N", "-", ".", "?"),
sep=",", dry=FALSE, verbose=FALSE) {
# Stop if ids are not unique
if (any(duplicated(data[[id]]))) {
stop("All values in the id column are not unique")
}
# Verify column classes and exit if they are incorrect
if (!is.null(text_fields)) {
if (!all(sapply(subset(data, select=text_fields), is.character))) {
stop("All text_fields columns must be of type 'character'")
}
}
if (!is.null(num_fields)) {
if (!all(sapply(subset(data, select=num_fields), is.numeric))) {
stop("All num_fields columns must be of type 'numeric'")
}
}
if (!is.null(seq_fields)) {
if (!all(sapply(subset(data, select=seq_fields), is.character))) {
stop("All seq_fields columns must be of type 'character'")
}
}
seq_len <- stri_length(data[[seq]])
if (any(seq_len != seq_len[1])) {
warning("All sequences are not the same length for data with first ",
id, " = ", data[[id]][1])
}
# Define verbose reporting function
.printVerbose <- function(n_total, n_unique, n_discard) {
cat(" FUNCTION> collapseDuplicates\n", sep="")
cat(" FIRST_ID> ", data[[id]][1], "\n", sep="")
cat(" TOTAL> ", n_total, "\n", sep="")
cat(" UNIQUE> ", n_unique, "\n", sep="")
cat("COLLAPSED> ", n_total - n_unique - n_discard, "\n", sep="")
cat("DISCARDED> ", n_discard, "\n", sep="")
cat("\n")
}
# Define function to count informative positions in sequences
.informativeLength <- function(x) {
stri_length(gsub("[N\\-\\.\\?]", "", x, perl=TRUE))
}
# Initialize collapse_count with 1 for each sequence
if(add_count) {
data[["collapse_count"]] <- rep(1, nrow(data))
num_fields <- c(num_fields, "collapse_count")
}
# Initialize dry run columns
if (dry) {
data$collapse_id <- NA
data$collapse_class <- NA
data$collapse_pass <- TRUE
}
# Return input if there are no sequences to collapse
nseq <- nrow(data)
if (nseq <= 1) {
if (verbose) { .printVerbose(nseq, 1, 0) }
if (dry) {
data[['collapse_id']] <- 1
data[['collapse_class']] <- "unique"
data[['collapse_pass']] <- TRUE
}
return(data)
}
# Build distance matrix
exact_duplicates <- any(duplicated(data[[seq]]))
d_mat <- pairwiseEqual(unique(data[[seq]]))
colnames(d_mat) <- rownames(d_mat) <- unique(data[[seq]])
n_uniqueseq <- nrow(d_mat)
# Return input if no sequences are equal
if (!any(d_mat[lower.tri(d_mat, diag=F)]) & !exact_duplicates) {
if (verbose) { .printVerbose(nseq, nseq, 0) }
if (dry) {
data[['collapse_id']] <- 1:nrow(data)
data[['collapse_class']] <- "unique"
data[['collapse_pass']] <- TRUE
}
return(data)
}
# Find sequences that will cluster ambiguously
ambig_rows <- numeric()
for (i in 1:n_uniqueseq) {
idx <- which(d_mat[i, ])
tmp_mat <- d_mat[idx, idx]
if (!all(tmp_mat)) {
ambig_rows <- append(ambig_rows, i)
}
}
discard_count <- length(ambig_rows)
# from ambiguous rows in d_mat to
# ambiguous rows in data
data_ambig_rows <- data[[seq]] %in% rownames(d_mat)[ambig_rows]
data_discard_count <- sum(data_ambig_rows)
if (dry & length(ambig_rows)>0) {
data[["collapse_class"]][data_ambig_rows] <- "ambiguous"
data[["collapse_pass"]][data_ambig_rows] <- FALSE
}
# Return single sequence if all or all but one sequence belong to ambiguous clusters
if (nrow(data) - data_discard_count <= 1) {
inform_len <- data.frame(list("inform_len"=.informativeLength(data[[seq]])))
# For each ambiguous cluster, return the best sequence
g <- igraph::simplify(igraph::graph_from_adjacency_matrix(d_mat))
inform_len$clusters <- igraph::components(g)$membership[data[[seq]]]
inform_len$select_id <- 1:nrow(inform_len)
selected <- inform_len %>%
dplyr::group_by(!!rlang::sym("clusters")) %>%
dplyr::slice(which.max(!!rlang::sym("inform_len"))) %>%
dplyr::ungroup() %>%
dplyr::select(!!rlang::sym("select_id")) %>% unlist()
if (verbose) { .printVerbose(nseq, 0, discard_count - 1) }
if (dry) {
data[["collapse_id"]] <- inform_len$clusters
data[["collapse_pass"]][selected] <- TRUE
} else {
return(data[selected, ])
}
}
# Exclude ambiguous sequences from clustering
if (!dry & discard_count > 0) {
d_mat <- d_mat[-ambig_rows, -ambig_rows, drop = FALSE] # 'drop = FALSE' to keep dataframe structure if only one sequence is left
data <- data[!data_ambig_rows,]
}
# Cluster remaining sequences into unique and duplicate sets
dup_taxa <- list()
uniq_taxa <- character()
done_taxa <- character()
taxa_names <- rownames(d_mat)
collapse_id <- 1
for (taxa_i in 1:length(taxa_names)) {
taxa <- taxa_names[taxa_i]
data_taxa_i <- which(data[[seq]] %in% taxa)
# Skip taxa if previously assigned to a cluster
# or if ambiguous
# (ambiguous taxa don't get their own collapse_id)
if (taxa %in% done_taxa) { next }
if (dry & taxa_i %in% ambig_rows) { next }
# Find all zero distance taxa
idx <- which(d_mat[taxa, ])
# Translate from d_mat idx to data idx
data_idx <- which(data[[seq]] %in% colnames(d_mat)[idx])
# Update vector of clustered taxa
done_taxa <- c(done_taxa, taxa_names[idx])
# Update collapse group
if (dry) {
data[["collapse_id"]][data_idx] <- paste(data[["collapse_id"]][data_idx], collapse_id, sep=",")
}
if (dry) {
#idx_copy <- idx
data_idx_copy <- data_idx
idx <- idx[idx %in% ambig_rows == FALSE]
data_idx <- which(data[[seq]] %in% colnames(d_mat)[idx])
}
if (length(data_idx) == 1) {
# Assign unique sequences to unique vector
uniq_taxa <- append(uniq_taxa, taxa_names[idx])
if (dry) {
if (length(data_idx_copy)==1) {
## 'truly' unique
data[["collapse_class"]][data_taxa_i] <- "unique"
} else {
## unique after ambiguous removal
data[["collapse_class"]][data_taxa_i] <- "ambiguous_duplicate"
}
data[["collapse_pass"]][data_taxa_i] <- TRUE
}
} else if (length(data_idx) > 1) {
# Assign clusters of duplicates to duplicate list
dup_taxa <- c(dup_taxa, list(taxa_names[idx]))
if (dry) {
# Keep collpase_pass==TRUE for the sequence with the
# larger number of informative positions
# (the first one if ties)
max_info_idx <- which.max(.informativeLength(data[[seq]][data_idx]))[1]
data[["collapse_class"]][data_idx] <- "duplicated"
data[["collapse_pass"]][data_idx[-max_info_idx]] <- FALSE
}
} else {
# Report error (should never occur)
stop("Error in distance matrix of collapseDuplicates")
}
collapse_id <- collapse_id + 1
}
if (dry) {
data[["collapse_id"]] <- sub("^NA,","",data[["collapse_id"]])
return(data)
}
# Collapse duplicate sets and append entries to unique data.frame
unique_list <- list(data[data[[seq]] %in% uniq_taxa, ])
for (taxa in dup_taxa) {
# Define row indices of identical sequences
idx <- which(data[[seq]] %in% taxa)
tmp_df <- data[idx[1], ]
if (length(idx) > 1) {
# Initialize with data from most informative sequence
seq_set <- data[idx, c(id, seq)]
inform_len <- .informativeLength(seq_set[[seq]])
max_inform <- which.max(inform_len)[1] # if ties, pick first
tmp_df <- data[idx[max_inform], ]
# Define set of text fields for row
for (f in text_fields) {
f_set <- na.omit(data[[f]][idx])
if (length(f_set) > 0) {
f_set <- unlist(strsplit(f_set, sep))
f_set <- sort(unique(f_set))
f_val <- paste(f_set, collapse=sep)
} else {
f_val <- NA
}
tmp_df[, f] <- f_val
}
# Sum numeric fields
for (f in num_fields) {
f_set <- na.omit(data[[f]][idx])
if (length(f_set) > 0) {
f_val <- sum(f_set)
} else {
f_val <- NA
}
tmp_df[, f] <- f_val
}
# Select sequence fields with fewest Ns
for (f in seq_fields) {
f_set <- na.omit(data[[f]][idx])
if (length(f_set) > 0) {
f_len <- .informativeLength(f_set)
f_val <- f_set[which.max(f_len)]
} else {
f_val <- NA
}
tmp_df[, f] <- f_val
}
}
# Add row to unique list
unique_list <- c(unique_list, list(tmp_df))
}
# Combine all rows into unique data.frame
unique_df <- as.data.frame(bind_rows(unique_list))
if (verbose) { .printVerbose(nseq, nrow(unique_df), discard_count) }
return(unique_df)
}
#### Transformation functions ####
#' Translate nucleotide sequences to amino acids
#'
#' \code{translateDNA} translates nucleotide sequences to amino acid sequences.
#'
#' @param seq vector of strings defining DNA sequence(s) to be converted to translated.
#' @param trim boolean flag to remove 3 nts from both ends of seq
#' (converts IMGT junction to CDR3 region).
#'
#' @return A vector of translated sequence strings.
#'
#' @seealso \code{\link[seqinr]{translate}}.
#'
#' @examples
#' # Translate a single sequence
#' translateDNA("ACTGACTCGA")
#'
#' # Translate a vector of sequences
#' translateDNA(ExampleDb$junction[1:3])
#'
#' # Remove the first and last codon from the translation
#' translateDNA(ExampleDb$junction[1:3], trim=TRUE)
#'
#' @export
translateDNA <- function (seq, trim=FALSE) {
# Function to translate a single string
.translate <- function(x) {
if (stri_length(x) >= 3 & !is.na(x)) {
stri_join(seqinr::translate(unlist(strsplit(x, "")), ambiguous=TRUE),
collapse="")
} else {
NA
}
}
# Remove 3 nucleotides from each end
# Eg, "ACTGACTCGA" -> "GACT" (with "ACT" and "CGA" removed)
if (trim) { seq <- substr(seq, 4, stri_length(seq) - 3) }
# Replace gaps with N
seq <- gsub("[-.]", "N", seq)
# Apply translation
aa <- sapply(seq, .translate, USE.NAMES=FALSE)
return(aa)
}
#' Masks gap characters in DNA sequences
#'
#' \code{maskSeqGaps} substitutes gap characters, \code{c("-", ".")}, with \code{"N"}
#' in a vector of DNA sequences.
#'
#' @param seq character vector of DNA sequence strings.
#' @param mask_char character to use for masking.
#' @param outer_only if \code{TRUE} replace only contiguous leading and trailing gaps;
#' if \code{FALSE} replace all gap characters.
#'
#' @return A modified \code{seq} vector with \code{"N"} in place of \code{c("-", ".")}
#' characters.
#'
#' @seealso See \link{maskSeqEnds} for masking ragged edges.
#'
#' @examples
#' # Mask with Ns
#' maskSeqGaps(c("ATG-C", "CC..C"))
#' maskSeqGaps("--ATG-C-")
#' maskSeqGaps("--ATG-C-", outer_only=TRUE)
#'
#' # Mask with dashes
#' maskSeqGaps(c("ATG-C", "CC..C"), mask_char="-")
#'
#' @export
maskSeqGaps <- function(seq, mask_char="N", outer_only=FALSE) {
if (outer_only) {
for (i in 1:length(seq)) {
head_match <- attr(regexpr("^[-\\.]+", seq[i]), "match.length")
tail_match <- attr(regexpr("[-\\.]+$", seq[i]), "match.length")
if (head_match > 0) {
seq[i] <- gsub("^[-\\.]+",
paste(rep(mask_char, head_match), collapse=""),
seq[i])
}
if (tail_match > 0) {
seq[i] <- gsub("[-\\.]+$",
paste(rep(mask_char, tail_match), collapse=""),
seq[i])
}
}
} else {
seq <- gsub("[-\\.]", mask_char, seq)
}
return(seq)
}
#' Masks ragged leading and trailing edges of aligned DNA sequences
#'
#' \code{maskSeqEnds} takes a vector of DNA sequences, as character strings,
#' and replaces the leading and trailing characters with \code{"N"} characters to create
#' a sequence vector with uniformly masked outer sequence segments.
#'
#' @param seq character vector of DNA sequence strings.
#' @param mask_char character to use for masking.
#' @param max_mask the maximum number of characters to mask. If set to 0 then
#' no masking will be performed. If set to \code{NULL} then the upper
#' masking bound will be automatically determined from the maximum
#' number of observed leading or trailing \code{"N"} characters amongst
#' all strings in \code{seq}.
#' @param trim if \code{TRUE} leading and trailing characters will be cut rather
#' than masked with \code{"N"} characters.
#' @return A modified \code{seq} vector with masked (or optionally trimmed) sequences.
#'
#' @seealso See \link{maskSeqGaps} for masking internal gaps.
#' See \link{padSeqEnds} for padding sequence of unequal length.
#'
#' @examples
#' # Default behavior uniformly masks ragged ends
#' seq <- c("CCCCTGGG", "NAACTGGN", "NNNCTGNN")
#' maskSeqEnds(seq)
#'
#' # Does nothing
#' maskSeqEnds(seq, max_mask=0)
#'
#' # Cut ragged sequence ends
#' maskSeqEnds(seq, trim=TRUE)
#'
#' # Set max_mask to limit extent of masking and trimming
#' maskSeqEnds(seq, max_mask=1)
#' maskSeqEnds(seq, max_mask=1, trim=TRUE)
#'
#' # Mask dashes instead of Ns
#' seq <- c("CCCCTGGG", "-AACTGG-", "---CTG--")
#' maskSeqEnds(seq, mask_char="-")
#'
#' @export
maskSeqEnds <- function(seq, mask_char="N", max_mask=NULL, trim=FALSE) {
# Find length of leading and trailing Ns
left_lengths <- attr(regexpr(paste0("(^", mask_char, "*)"), seq, perl=T), "capture.length")
right_lengths <- attr(regexpr(paste0("(", mask_char, "*$)"), seq, perl=T), "capture.length")
# Mask to minimal inner sequence length
left_mask <- min(max(left_lengths[, 1]), max_mask)
right_mask <- min(max(right_lengths[, 1]), max_mask)
seq_lengths <- stri_length(seq)
if (trim) {
seq <- substr(seq, left_mask + 1, seq_lengths - right_mask)
} else {
substr(seq, 0, left_mask) <- paste(rep(mask_char, left_mask), collapse='')
substr(seq, seq_lengths - right_mask + 1, seq_lengths + 1) <-
paste(rep(mask_char, right_mask), collapse='')
}
return(seq)
}
#' Pads ragged ends of aligned DNA sequences
#'
#' \code{padSeqEnds} takes a vector of DNA sequences, as character strings,
#' and appends the ends of each sequence with an appropriate number of \code{"N"}
#' characters to create a sequence vector with uniform lengths.
#'
#' @param seq character vector of DNA sequence strings.
#' @param len length to pad to. Only applies if longer than the maximum length of
#' the data in \code{seq}.
#' @param start if \code{TRUE} pad the beginning of each sequence instead of the end.
#' @param pad_char character to use for padding.
#' @param mod3 if \code{TRUE} pad sequences to be of length multiple three.
#'
#' @return A modified \code{seq} vector with padded sequences.
#'
#' @seealso See \link{maskSeqEnds} for creating uniform masking from existing masking.
#'
#' @examples
#' # Default behavior uniformly pads ragged ends
#' seq <- c("CCCCTGGG", "ACCCTG", "CCCC")
#' padSeqEnds(seq)
#'
#' # Pad to fixed length
#' padSeqEnds(seq, len=15)
#'
#' # Add padding to the beginning of the sequences instead of the ends
#' padSeqEnds(seq, start=TRUE)
#' padSeqEnds(seq, len=15, start=TRUE)
#'
#' @export
padSeqEnds <- function(seq, len=NULL, start=FALSE, pad_char="N", mod3=TRUE) {
# Set length to max input length
width <- max(stringi::stri_length(seq),len)
if (mod3 && width %% 3 != 0) {
width <- width + (3 - width %% 3)
}
# Pad
if (!start) {
seq <- stringi::stri_pad_right(seq, width=width, pad=pad_char)
} else {
seq <- stringi::stri_pad_left(seq, width=width, pad=pad_char)
}
return(seq)
}
#### Subregion functions ####
#' Extracts FWRs and CDRs from IMGT-gapped sequences
#'
#' \code{extractVRegion} extracts the framework and complementarity determining regions of
#' the V segment for IMGT-gapped immunoglobulin (Ig) nucleotide sequences according to the
#' IMGT numbering scheme.
#'
#' @param sequences character vector of IMGT-gapped nucleotide sequences.
#' @param region string defining the region(s) of the V segment to extract.
#' May be a single region or multiple regions (as a vector) from
#' \code{c("fwr1", "cdr1", "fwr2", "cdr2" ,"fwr3")}. By default, all
#' regions will be returned.
#'
#' @return If only one region is specified in the \code{region} argument, a character
#' vector of the extracted sub-sequences will be returned. If multiple regions
#' are specified, then a character matrix will be returned with columns
#' corresponding to the specified regions and a row for each entry in
#' \code{sequences}.
#'
#' @seealso IMGT-gapped region boundaries are defined in \link{IMGT_REGIONS}.
#'
#' @references
#' \enumerate{
#' \item Lefranc M-P, et al. IMGT unique numbering for immunoglobulin and T cell
#' receptor variable domains and Ig superfamily V-like domains.
#' Dev Comp Immunol. 2003 27(1):55-77.
#' }
#'
#' @examples
#' # Assign example clone
#' clone <- subset(ExampleDb, clone_id == 3138)
#'
#' # Get all regions
#' extractVRegion(clone$sequence_alignment)
#'
#' # Get single region
#' extractVRegion(clone$sequence_alignment, "fwr1")
#'
#' # Get all CDRs
#' extractVRegion(clone$sequence_alignment, c("cdr1", "cdr2"))
#'
#' # Get all FWRs
#' extractVRegion(clone$sequence_alignment, c("fwr1", "fwr2", "fwr3"))
#'
#' @export
extractVRegion <- function(sequences, region=c("fwr1", "cdr1", "fwr2", "cdr2", "fwr3")) {
# Check region argument
region <- match.arg(region, several.ok=TRUE)
if (length(region) == 1) {
sub_sequences <- substr(sequences,
IMGT_REGIONS[[region]][1],
IMGT_REGIONS[[region]][2])
} else {
sub_sequences <- sapply(region, function(x) substr(sequences,
IMGT_REGIONS[[x]][1],
IMGT_REGIONS[[x]][2]))
}
return(sub_sequences)
}
#' Calculate junction region alignment properties
#'
#' \code{junctionAlignment} determines the number of deleted germline nucleotides in the
#' junction region and the number of V gene and J gene nucleotides in the CDR3.
#'
#' @param data \code{data.frame} containing sequence data.
#' @param germline_db reference germline database for the V, D and J genes.
#' in \code{data}
#' @param v_call V gene assignment column.
#' @param d_call D gene assignment column.
#' @param j_call J gene assignment column.
#' @param v_germline_start column containing the start position of the alignment
#' in the V reference germline.
#' @param v_germline_end column containing the end position of the alignment in the
#' V reference germline.
#' @param d_germline_start column containing the start position of the alignment
#' in the D reference germline.
#' @param d_germline_end column containing the start position of the alignment
#' in the D reference germline.
#' @param j_germline_start column containing the start position of the alignment
#' in the J reference germline.
#' @param j_germline_end column containing the start position of the alignment
#' in the J reference germline.
#' @param np1_length combined length of the N and P regions between the
#' V and D regions (heavy chain) or V and J regions (light chain).
#' @param np2_length combined length of the N and P regions between the
#' D and J regions (heavy chain).
#' @param junction column containing the junction sequence.
#' @param junction_length column containing the length of the junction region in nucleotides.
#' @param sequence_alignment column containing the aligned sequence.
#'
#' @return A modified input \code{data.frame} with the following additional columns storing
#' junction alignment information:
#' \enumerate{
#' \item \code{e3v_length}: number of 3' V germline nucleotides deleted.
#' \item \code{e5d_length}: number of 5' D germline nucleotides deleted.
#' \item \code{e3d_length}: number of 3' D germline nucleotides deleted.
#' \item \code{e5j_length}: number of 5' J germline nucleotides deleted.
#' \item \code{v_cdr3_length}: number of sequence_alignment V nucleotides in the CDR3.
#' \item \code{j_cdr3_length}: number of sequence_alignment J nucleotides in the CDR3.
#' }
#'
#' @examples
#' germline_db <- list(
#' "IGHV3-11*05"="CAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACT
#' CTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAG
#' GGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG
#' ...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGA
#' CACGGCCGTGTATTACTGTGCGAGAGA",
#' "IGHD3-10*01"="GTATTACTATGGTTCGGGGAGTTATTATAAC",
#' "IGHJ5*02"="ACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG"
#' )
#'
#' db <- junctionAlignment(SingleDb, germline_db)
#'
#' @export
junctionAlignment <- function(data, germline_db,
v_call="v_call",
d_call="d_call",
j_call="j_call",
v_germline_start="v_germline_start",
v_germline_end="v_germline_end",
d_germline_start="d_germline_start",
d_germline_end="d_germline_end",
j_germline_start="j_germline_start",
j_germline_end="j_germline_end",
np1_length="np1_length",
np2_length="np2_length",
junction="junction",
junction_length="junction_length",
sequence_alignment="sequence_alignment") {
# Check input
check <- checkColumns(data,
c(v_call, d_call, j_call,
v_germline_start, v_germline_end,
d_germline_start, d_germline_end,
j_germline_start, j_germline_end,
np1_length, np2_length,
junction, junction_length,
sequence_alignment))
if (check != TRUE) { stop(check) }
# Get deletions
for (i in 1:nrow(data)) {
v_dels <- countDeleted(data[i,],
allele_call=v_call, germline_start=v_germline_start, germline_end=v_germline_end,
germline_db=germline_db, junction=junction, junction_length=junction_length,
sequence_alignment=sequence_alignment)
d_dels <- countDeleted(data[i,],
allele_call=d_call, germline_start=d_germline_start, germline_end=d_germline_end,
germline_db=germline_db, junction=junction, junction_length=junction_length,
sequence_alignment=sequence_alignment)
j_dels <- countDeleted(data[i,],
allele_call=j_call, germline_start=j_germline_start, germline_end=j_germline_end,
germline_db=germline_db, junction=junction, junction_length=junction_length,
sequence_alignment=sequence_alignment)
data[['e3v_length']][i] <- v_dels[2]
data[['e5d_length']][i] <- d_dels[1]
data[['e3d_length']][i] <- d_dels[2]
data[['e5j_length']][i] <- j_dels[1]
data[['v_cdr3_length']][i] <- v_dels[3]
data[['j_cdr3_length']][i] <- j_dels[3]
}
return(data)
}
# Junction alignment helper
#
# Report the number of deleted germline nucleotides in the alignment
#
# @param db_row one row from a Rearrangement database.
# @param allele_call column containing gene assignments.
# @param germline_start column containing the start position of the alignment in the reference germline.
# @param germline_end column containing the end position of the alignment in the reference germline.
# @param germline_db reference germline database for the V, D and J genes.
# @param junction column containing the junction sequence.
# @param junction_length column containing the length of the junction region in nucleotides.
# @param sequence_alignment column containing the aligned sequence.
#
# @return Alignment deletions
countDeleted <- function(db_row, allele_call, germline_start, germline_end,
germline_db, junction, junction_length,
sequence_alignment) {
# db_row: one row from data
# allele_call: one of v,d,j
# germline_db: the reference germline database used to assign genes.
allele <- getAllele(db_row[[allele_call]], first=T)
deleted <- c(NA, NA, NA)
# Check for valid allele information
if (is.na(allele)) {
return(deleted)
}
# Check for allele in reference germlines
tryCatch(germline <- germline_db[[allele]],
error=function(e) { stop(allele, " not found in germline_db.") })
allele_germline_start <- as.numeric(db_row[[germline_start]])
allele_germline_end <- as.numeric(db_row[[germline_end]])
germline_head <- stringi::stri_sub(germline, 1, allele_germline_start - 1)
deleted_head <- nchar(gsub("\\.", "", germline_head))
germline_tail <- stringi::stri_sub(germline, allele_germline_end+1, nchar(germline))
deleted_tail <- nchar(gsub("\\.", "", germline_tail))
deleted[1] <- deleted_head
deleted[2] <- deleted_tail
if (is.na(db_row[[junction]])) {
warning("NA junction found.")
return (deleted)
}
if (!db_row[[junction_length]]>6) {
message("Junction length <= 6.")
return (deleted)
}
junction_len <- db_row[[junction_length]]
junction_start <- 310
# junction_end <- junction_start + junction_len - 1
# get aligned junction end (counting gaps)
seq_aln <- s2c(db_row[[sequence_alignment]]) != "-"
seq_aln[1:junction_start-1] <- 0
junction_end <- which(cumsum(seq_aln[1:length(seq_aln)]) > junction_len)[1] - 1
# For V and J alleles, calculate number of nt in the CDR3
germ_cdr3_length <- NA
if (grepl("[Vv]", allele)) {
last_cdr3_pre_np <- db_row[[germline_end]] - db_row[[germline_start]] + 1
first_cdr3_pre_np <- junction_start + 3 # without conserved
# len <- last_cdr3_pre_np - first_cdr3_pre_np + 1
#germ_seq <- stringi::stri_sub(germline, db_row[[germline_end]]+1-len, db_row[[germline_end]] )
germ_seq <- stringi::stri_sub(db_row[[sequence_alignment]], first_cdr3_pre_np, last_cdr3_pre_np )
germ_cdr3_length <- nchar(gsub("[\\.-]", "", germ_seq))
} else if (grepl("[Jj]", allele)) {
j_aln_len <- db_row[[germline_end]] - db_row[[germline_start]] + 1
# germ_seq <- stringi::stri_sub(germline, db_row[[germline_start]], db_row[[germline_end]]-j_tail)
germ_seq <- stringi::stri_sub(db_row[[sequence_alignment]],
nchar(db_row[[sequence_alignment]]) - j_aln_len + 1,
junction_end - 3)
germ_cdr3_length <- nchar(gsub("-", "", germ_seq))
}
deleted <- c(deleted_head, deleted_tail, germ_cdr3_length)
return(deleted)
}
#### Rcpp wrappers ####
#' Calculate distance between two sequences
#'
#' \code{seqDist} calculates the distance between two DNA sequences.
#'
#' @param seq1 character string containing a DNA sequence.
#' @param seq2 character string containing a DNA sequence.
#' @param dist_mat Character distance matrix. Defaults to a Hamming distance
#' matrix returned by \link{getDNAMatrix}. If gap
#' characters, \code{c("-", ".")}, are assigned a value of -1
#' in \code{dist_mat} then contiguous gaps of any run length,
#' which are not present in both sequences, will be counted as a
#' distance of 1. Meaning, indels of any length will increase
#' the sequence distance by 1. Gap values other than -1 will
#' return a distance that does not consider indels as a special case.
#'
#' @return Numerical distance between \code{seq1} and \code{seq2}.
#'
#' @seealso Nucleotide distance matrix may be built with
#' \link{getDNAMatrix}. Amino acid distance matrix may be built
#' with \link{getAAMatrix}. Used by \link{pairwiseDist} for generating
#' distance matrices. See \link{seqEqual} for testing sequence equivalence.
#'
#' @examples
#' # Ungapped examples
#' seqDist("ATGGC", "ATGGG")
#' seqDist("ATGGC", "ATG??")
#'
#' # Gaps will be treated as Ns with a gap=0 distance matrix
#' seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=0))
#'
#' # Gaps will be treated as universally non-matching characters with gap=1
#' seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=1))
#'
#' # Gaps of any length will be treated as single mismatches with a gap=-1 distance matrix
#' seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
#'
#' # Gaps of equivalent run lengths are not counted as gaps
#' seqDist("ATG-C", "ATG-C", dist_mat=getDNAMatrix(gap=-1))
#'
#' # Overlapping runs of gap characters are counted as a single gap
#' seqDist("ATG-C", "AT--C", dist_mat=getDNAMatrix(gap=-1))
#' seqDist("A-GGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
#' seqDist("AT--C", "AT--C", dist_mat=getDNAMatrix(gap=-1))
#'
#' # Discontiguous runs of gap characters each count as separate gaps
#' seqDist("-TGGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
#'
#' @export
seqDist <- function(seq1, seq2, dist_mat=getDNAMatrix()) {
seqDistRcpp(seq1, seq2, dist_mat)
}
#' Calculate pairwise distances between sequences
#'
#' \code{pairwiseDist} calculates all pairwise distance between a set of sequences.
#'
#' @param seq character vector containing a DNA sequences.
#' @param dist_mat Character distance matrix. Defaults to a Hamming distance
#' matrix returned by \link{getDNAMatrix}. If gap
#' characters, \code{c("-", ".")}, are assigned a value of -1
#' in \code{dist_mat} then contiguous gaps of any run length,
#' which are not present in both sequences, will be counted as a
#' distance of 1. Meaning, indels of any length will increase
#' the sequence distance by 1. Gap values other than -1 will
#' return a distance that does not consider indels as a special case.
#'
#' @return A matrix of numerical distance between each entry in \code{seq}.
#' If \code{seq} is a named vector, row and columns names will be added
#' accordingly.
#'
#' Amino acid distance matrix may be built with \link{getAAMatrix}.
#' Uses \link{seqDist} for calculating distances between pairs.
#' See \link{pairwiseEqual} for generating an equivalence matrix.
#'
#' @examples
#' # Gaps will be treated as Ns with a gap=0 distance matrix
#' pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
#' dist_mat=getDNAMatrix(gap=0))
#'
#' # Gaps will be treated as universally non-matching characters with gap=1
#' pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
#' dist_mat=getDNAMatrix(gap=1))
#'
#' # Gaps of any length will be treated as single mismatches with a gap=-1 distance matrix
#' pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
#' dist_mat=getDNAMatrix(gap=-1))
#'
#' @export
pairwiseDist <- function(seq, dist_mat=getDNAMatrix()) {
pairwiseDistRcpp(seq, dist_mat)
}
#' Calculate pairwise distances between sequences
#'
#' \code{nonsquareDist} calculates all pairwise distance between a set of sequences and a subset of it.
#'
#' @param seq character vector containing a DNA sequences. The sequence vector needs to
#' be named.
#' @param indx numeric vector containing the indices (a subset of indices of \code{seq}).
#' @param dist_mat Character distance matrix. Defaults to a Hamming distance
#' matrix returned by \link{getDNAMatrix}. If gap
#' characters, \code{c("-", ".")}, are assigned a value of -1
#' in \code{dist_mat} then contiguous gaps of any run length,
#' which are not present in both sequences, will be counted as a
#' distance of 1. Meaning, indels of any length will increase
#' the sequence distance by 1. Gap values other than -1 will
#' return a distance that does not consider indels as a special case.
#'
#' @return A matrix of numerical distance between each entry in \code{seq} and
#' sequences specified by \code{indx} indices.
#'
#' Note that the input subsampled indices will be ordered ascendingly. Therefore,
#' it is necessary to assign unique names to the input sequences, \code{seq},
#' to recover the input order later. Row and columns names will be added accordingly.
#'
#' Amino acid distance matrix may be built with \link{getAAMatrix}.
#' Uses \link{seqDist} for calculating distances between pairs.
#' See \link{pairwiseEqual} for generating an equivalence matrix.
#'
#' @examples
#' # Gaps will be treated as Ns with a gap=0 distance matrix
#' seq <- c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C")
#' pairwiseDist(seq,
#' dist_mat=getDNAMatrix(gap=0))
#'
#' nonsquareDist(seq, indx=c(1,3),
#' dist_mat=getDNAMatrix(gap=0))
#'
#' @export
nonsquareDist <- function(seq, indx, dist_mat=getDNAMatrix()) {
nonsquareDistRcpp(seq, indx, dist_mat)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.