Nothing
##' read sequence alignment file
##'
##'
##' @rdname msa-read
##' @param file multiple sequence file
##' @param type one of 'DNA', 'RNA', 'AA', 'Protein', 'unknown' or 'auto'
##' @return BStringSet object
##' @importFrom Biostrings readBStringSet
##' @importFrom Biostrings readDNAStringSet
##' @importFrom Biostrings readRNAStringSet
##' @importFrom Biostrings readAAStringSet
##' @export
##' @author Guangchuang Yu
##' @examples
##' fa_file <- system.file("extdata/HA.fas", package="seqmagick")
##' fa_read(fa_file)
##'
##' mega_file <- system.file("extdata/mega/Crab_rRNA.meg", package="seqmagick")
##' mega_read(mega_file)
fa_read <- function(file, type = "auto") {
type <- match.arg(type, c("DNA", "RNA", "AA", "unknown", "auto" ))
if (type == "auto") {
type <- guess_sequence_type(file)
}
type <- toupper(type)
switch(type,
DNA = readDNAStringSet(file),
RNA = readRNAStringSet(file),
AA = readAAStringSet(file),
PROTEIN = readAAStringSet(file),
UNKNOWN = readBStringSet(file)
)
}
##' read aligned sequences in phylip format
##'
##'
##' @title phy_read
##' @param file phylip file
##' @importFrom Biostrings BStringSet
##' @return BStringSet object
##' @export
##' @author Guangchuang Yu
##' @examples
##' phy_file <- system.file("extdata/HA.phy", package="seqmagick")
##' phy_read(phy_file)
phy_read <- function(file) {
info <- getPhyInfo(file)
phy <- readLines(file)
type <- "interleaved"
if (length(phy) == (info$num + 1)) {
type <- "sequential"
}
if (type == "sequential") {
phy <- phy[-1]
ii <- nchar(phy) - info$width
nm <- gsub("\\s+$", "", substring(phy, 1,ii-1))
seq_str <- substring(phy, ii+1, nchar(phy))
## may use \t and lines are not in equal length
## nm <- gsub("\\s+[^\\s]+$", "", phy)
## seq_str <- gsub("^[^\\s]+\\s+", "", phy)
} else {
phy <- phy[nchar(phy) != 0]
phy <- phy[-1]
ii <- regexpr("\\S", phy[info$num+2])
nn <- nchar(phy[info$num+2])
nm <- gsub("\\s+$", "", substring(phy[1:info$num], 1,ii-1))
ss <- substring(phy, ii, nn)
seq_str <- sapply(1:info$num, function(i) {
j <- seq(i, length(ss), by=info$num)
paste0(ss[j], sep="", collapse="") %>% gsub(" ", "", .)
})
}
names(seq_str) <- nm
## BStringSet(seq_str)
switch(guess_sequence_type(seq_str[1]),
DNA = DNAStringSet(seq_str),
RNA = RNAStringSet(seq_str),
AA = AAStringSet(seq_str))
}
guess_sequence_type <- function(string) {
if (file.exists(string)){
seqstr <- readLines(string, n=3)
if (length(seqstr)==2 || grepl("^>", seqstr[[3]])){
# >seq1
# AGCGTACGTGACGTAGCGTAGC
# >seq2
a <- seqstr[2]
}else{
# >seq1
# ---------
# AGCG----C
# ---------
# >seq2
seqstr <- readLines(string, n=20)
seqind <- grep("^>", seqstr)
if (length(seqind)==1){
a <- paste0(seqstr[-1], collapse="")
}else{
inds <- seqind[1] + 1
inde <- seqind[2] - 1
a <- paste0(seqstr[inds:inde], collapse="")
}
}
}else{
a <- string
}
a <- strsplit(toupper(a), split="")[[1]]
freq1 <- mean(a %in% c('A', 'C', 'G', 'T', 'X', 'N', '-') )
freq2 <- mean(a %in% c('A', 'C', 'G', 'T', 'N'))
if (freq1 > 0.9 && freq2 > 0) {
return('DNA')
}
freq3 <- mean(a %in% c('A', 'C', 'G', 'U', 'X', 'N', '-'))
freq4 <- mean(a %in% c('T'))
freq5 <- mean(a %in% c('U'))
if (freq3 > 0.9 && freq4==0 && freq5 > 0) {
return('RNA')
}
return('AA')
}
##' extract accession number and sequence from genbank file
##'
##'
##' @title gb_read
##' @param file input genbank file
##' @return sequence object
##' @export
##' @author Guangchuang Yu
gb_read <- function(file) {
res <- vapply(file, gb_read_item, FUN.VALUE = character(1))
f <- tempfile(fileext = ".fasta")
cat(res, file = f, sep="")
fa_read(f)
}
gb_read_item <- function(file) {
x <- readLines(file)
acc <- sub("\\w+\\s+(\\w+)$", "\\1", x[grep("^ACCESSION", x)])
src <- sub("SOURCE\\s+", "", x[grep("^SOURCE",x)])
header <- paste0(src, "(", acc, ")")
i <- grep("ORIGIN", x)
ss <- x[(i+1):length(x)]
ss <- ss[1:(grep("//", ss) -1)]
ss <- gsub("\\s+\\d+", "", ss)
ss <- gsub("\\s+", "", ss)
ss <- paste0(ss, collapse = "")
# f <- tempfile(fileext = ".fasta")
# cat(">", file = f, append = TRUE)
# cat(header, file = f, append = TRUE, sep = "\n")
# cat(ss, file = f, append = TRUE, sep = "\n")
# fa_read(f)
sprintf(">%s\n%s\n", header, ss)
}
#' @rdname msa-read
#' @export
clw_read <- function(file, type = "auto") {
x <- readLines(file)
program <- toupper(sub("(\\w+)\\s.*", "\\1", x[1], perl=use_perl()))
if (!program %in% c("CLUSTAL", "MUSCLE")) {
stop("wrong file format")
}
i <- grep("^\\s+", x, perl=use_perl())
x <- x[-c(1, i)]
y <- parse_name_seq(x)
y <- collapse_seqs(y$seqname, y$seqs)
build_seq_object(y, type)
}
#' @rdname msa-read
#' @export
#' @importFrom stats setNames
sth_read <- function(file, type = "auto") {
# STOCKHOLM file
x <- readLines(file)
if (!grepl("STOCKHOLM", x[1], perl=use_perl())) {
stop("wrong file format")
}
seqname <- x[grep("^#=GS", x, perl=use_perl())]
seqname <- sub("#=GS\\s(\\S+)\\s.*", "\\1", seqname, perl=use_perl())
key <- sub("^(\\S+)\\s.*", "\\1", x, perl=use_perl())
value <- sub("^\\S+\\s+", "", x, perl=use_perl())
i <- which(key %in% seqname)
seqs <- setNames(value[i], key[i])
build_seq_object(seqs, type)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.