tests/testthat/test_bioio.R
In abruyneel/AlleleProfileR: Genome editing strategy agnostic variant identification and profiling tool
context("bioio")
library(AlleleProfileR)
#
test_that("bioio", {
# comparison with samtools faidx frag.fa chr10:40-60
expect_equal(getreferenceC("files/index/frag.fa", "chr10", 40, 60), "CTGCCCAGCTAAGCTCCCATA")
})
abruyneel/AlleleProfileR documentation built on June 12, 2020, 2:47 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
context("bioio")
library(AlleleProfileR)
#
test_that("bioio", {
# comparison with samtools faidx frag.fa chr10:40-60
expect_equal(getreferenceC("files/index/frag.fa", "chr10", 40, 60), "CTGCCCAGCTAAGCTCCCATA")
})
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.