in_silico_PCR: in silico PCR

In avhgenomics/bioKIT: bioKIT: Common functions for routine molecular biology applications.

Description

Builds a request and parses the output of UCSC's in silico PCR.

Usage

in_silico_PCR(forward_primer, reverse_primer, mRNA_primers = F,
  genome_version = "mm10", max_product_size = 4000,
  min_perfect_match = 15, min_good_match = 15, flip_reverse_primer = F)

Arguments

forward_primer	string containing the forward primer sequence.
reverse_primer	string containing the reverse primer sequence.
mRNA_primers	Test the UCSC Genes assembly? False by default, tests the genome assembly.
genome_version	mm10 by default, mm9 is also valid.
max_product_size	max bp size for the product. integer.
min_perfect_match	minimum perfect match, typically left as is.
min_good_match	minimum good match, typically left as is.
flip_reverse_primer	flip the reverse primer? False by default.

Value

returns a string of the predicted amplification region(s).

Examples

#negative result
#in_silico_PCR(forward_primer = "AGCCTCCAAAACCAAGGTGA",reverse_primer = "ATCTGGTCAACCACCTCCTT")
#positive result
#in_silico_PCR(forward_primer = "TTCTCTGTCATGGAACCCTATTC",reverse_primer = "CAGGAGAGAGTAGTCCACAGTA")

avhgenomics/bioKIT documentation built on May 5, 2019, 12:29 a.m.