knitr::opts_chunk$set(collapse=TRUE, comment = "#>") suppressPackageStartupMessages(library(universalmotif)) suppressPackageStartupMessages(library(Biostrings)) suppressPackageStartupMessages(library(GenomicRanges)) suppressPackageStartupMessages(library(ggbio)) data(ArabidopsisPromoters) data(ArabidopsisMotif) options(Biostrings.coloring = FALSE)
This vignette goes through generating your own sequences from a specified background model, shuffling sequences whilst maintaining a certain k
-let size, and the scanning of sequences and scoring of motifs. For an introduction to sequence motifs, see the introductory vignette. For a basic overview of available motif-related functions, see the motif manipulation vignette. For a discussion on motif comparisons and P-values, see the motif comparisons and P-values vignette.
The Biostrings
package offers an excellent suite of functions for dealing with biological sequences. The universalmotif
package hopes to help extend these by providing the create_sequences()
and shuffle_sequences()
functions. The first of these, create_sequences()
, generates a set of letters in random order, then passes these strings to the Biostrings
package to generate the final XStringSet
object. The number and length of sequences can be specified. The probabilities of individual letters can also be set.
The freqs
option of create_sequences()
also takes higher order backgrounds. In these cases the sequences are constructed in a Markov-style manner, where the probability of each letter is based on which letters precede it.
library(universalmotif) library(Biostrings) ## Create some DNA sequences for use with an external program (default ## is DNA): sequences.dna <- create_sequences(seqnum = 500, freqs = c(A=0.3, C=0.2, G=0.2, T=0.3)) ## writeXStringSet(sequences.dna, "dna.fasta") sequences.dna ## Amino acid: create_sequences(alphabet = "AA") ## Any set of characters can be used create_sequences(alphabet = paste0(letters, collapse = ""))
Sequence backgrounds can be retrieved for DNA and RNA sequences with oligonucleotideFrequency()
from "Biostrings
. Unfortunately, no such Biostrings
function exists for other sequence alphabets. The universalmotif
package proves get_bkg()
to remedy this. Similarly, the get_bkg()
function can calculate higher order backgrounds for any alphabet as well. It is recommended to use the original Biostrings
for very long (e.g. billions of characters) DNA and RNA sequences whenever possible though, as it is much faster than get_bkg()
.
library(universalmotif) ## Background of DNA sequences: dna <- create_sequences() get_bkg(dna, k = 1:2) ## Background of non DNA/RNA sequences: qwerty <- create_sequences("QWERTY") get_bkg(qwerty, k = 1:2)
One way to compare sequences is by k-let composition. The following example illustrates how one could go about doing this using only the universalmotif
package and base graphics.
library(universalmotif) ## Generate three random sets of sequences: s1 <- create_sequences(seqnum = 20, freqs = c(A = 0.3, C = 0.2, G = 0.2, T = 0.3)) s2 <- create_sequences(seqnum = 20, freqs = c(A = 0.4, C = 0.4, G = 0.1, T = 0.1)) s3 <- create_sequences(seqnum = 20, freqs = c(A = 0.2, C = 0.3, G = 0.3, T = 0.2)) ## Create a function to get properly formatted k-let counts: get_klet_matrix <- function(seqs, k, groupName) { bkg <- get_bkg(seqs, k = k, merge.res = FALSE) bkg <- bkg[, c("sequence", "klet", "count")] bkg <- reshape(bkg, idvar = "sequence", timevar = "klet", direction = "wide") suppressWarnings(as.data.frame(cbind(Group = groupName, bkg))) } ## Calculate k-let content (up to you what size k you want!): s1 <- get_klet_matrix(s1, 4, 1) s2 <- get_klet_matrix(s2, 4, 2) s3 <- get_klet_matrix(s3, 4, 3) # Combine everything into a single object: sAll <- rbind(s1, s2, s3) ## Do the PCA: sPCA <- prcomp(sAll[, -(1:2)]) ## Plot the PCA: plot(sPCA$x, col = c("red", "forestgreen", "blue")[sAll$Group], pch = 19)
This example could be improved by using tidyr::spread()
instead of reshape()
(the former is much faster), and plotting the PCA using the ggfortify
package to create a nicer ggplot2
plot. Feel free to play around with different ways of plotting the data! Additionally, you could even try using t-SNE instead of PCA (such as via the Rtsne
package).
When performing de novo motif searches or motif enrichment analyses, it is common to do so against a set of background sequences. In order to properly identify consistent patterns or motifs in the target sequences, it is important that there be maintained a certain level of sequence composition between the target and background sequences. This reduces results which are derived purely from base differential letter frequency biases.
In order to avoid these results, typically it desirable to use a set of background sequences which preserve a certain k
-let size (such as dinucleotide or trinucleotide frequencies in the case of DNA sequences). Though for some cases a set of similar sequences may already be available for use as background sequences, usually background sequences are obtained by shuffling the target sequences, while preserving a desired k
-let size. For this purpose, a commonly used tool is uShuffle
[@ushuffle]. The universalmotif
package aims to provide its own k
-let shuffling capabilities for use within R
via shuffle_sequences()
.
The universalmotif
package offers three different methods for sequence shuffling: euler
, markov
and linear
. The first method, euler
, can shuffle sequences while preserving any desired k
-let size. Furthermore 1-letter counts will always be maintained. However due to the nature of the method, the first and last letters will remain unshuffled. This method is based on the initial random Eulerian walk algorithm proposed by @markovmodel2 and the subsequent cycle-popping algorithm detailed by @eulerAlgo for quickly and efficiently finding Eulerian walks.
The second method, markov
can only guarantee that the approximate k
-let frequency will be maintained, but not that the original letter counts will be preserved. The markov
method involves determining the original k
-let frequencies, then creating a new set of sequences which will have approximately similar k
-let frequency. As a result the counts for the individual letters will likely be different. Essentially, it involves a combination of determining k
-let frequencies followed by create_sequences()
. This type of pseudo-shuffling is discussed by @markovmodel.
The third method linear
preserves the original 1-letter counts exactly, but uses a more crude shuffling technique. In this case the sequence is split into sub-sequences every k
-let (of any size), which are then re-assembled randomly. This means that while shuffling the same sequence multiple times with method = "linear"
will result in different sequences, they will all have started from the same set of k
-length sub-sequences (just re-assembled differently).
library(universalmotif) library(Biostrings) data(ArabidopsisPromoters) ## Potentially starting off with some external sequences: # ArabidopsisPromoters <- readDNAStringSet("ArabidopsisPromoters.fasta") euler <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "euler") markov <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "markov") linear <- shuffle_sequences(ArabidopsisPromoters, k = 2, method = "linear") k1 <- shuffle_sequences(ArabidopsisPromoters, k = 1)
Let us compare how the methods perform:
o.letter <- get_bkg(ArabidopsisPromoters, 1) e.letter <- get_bkg(euler, 1) m.letter <- get_bkg(markov, 1) l.letter <- get_bkg(linear, 1) data.frame(original=o.letter$count, euler=e.letter$count, markov=m.letter$count, linear=l.letter$count, row.names = DNA_BASES) o.counts <- get_bkg(ArabidopsisPromoters, 2) e.counts <- get_bkg(euler, 2) m.counts <- get_bkg(markov, 2) l.counts <- get_bkg(linear, 2) data.frame(original=o.counts$count, euler=e.counts$count, markov=m.counts$count, linear=l.counts$count, row.names = get_klets(DNA_BASES, 2))
If you have a fairly heterogeneous sequence and wish to preserve the presence of local "patches" of differential sequence composition, you can set window = TRUE
in the shuffle_sequences()
function. In the following example, the sequence of interest has an AT rich first half followed by a second half with an even background. The impact on this specific sequence composition is observed after regular and local shuffling, using the per-window functionality of get_bkg()
(via window = TRUE
). Fine-tune the window size and overlap between windows with window.size
and window.overlap
.
library(Biostrings) library(universalmotif) library(ggplot2) myseq <- DNAStringSet(paste0( create_sequences(seqlen = 500, freqs = c(A=0.4, T=0.4, C=0.1, G=0.1)), create_sequences(seqlen = 500) )) myseq_shuf <- shuffle_sequences(myseq) myseq_shuf_local <- shuffle_sequences(myseq, window = TRUE) myseq_bkg <- get_bkg(myseq, k = 1, window = TRUE) myseq_shuf_bkg <- get_bkg(myseq_shuf, k = 1, window = TRUE) myseq_shuf_local_bkg <- get_bkg(myseq_shuf_local, k = 1, window = TRUE) myseq_bkg$group <- "original" myseq_shuf_bkg$group <- "shuffled" myseq_shuf_local_bkg$group <- "shuffled-local" myseq_all <- suppressWarnings(as.data.frame( rbind(myseq_bkg, myseq_shuf_bkg, myseq_shuf_local_bkg) )) ggplot(myseq_all, aes(x = start, y = probability, colour = klet)) + geom_line() + theme_minimal() + scale_colour_manual(values = universalmotif:::DNA_COLOURS) + xlab(element_blank()) + facet_wrap(~group, ncol = 1)
There are many motif-programs available with sequence scanning capabilities, such as HOMER and tools from the MEME suite. The universalmotif
package does not aim to supplant these, but rather provide convenience functions for quickly scanning a few sequences without needing to leave the R
environment. Furthermore, these functions allow for taking advantage of the higher-order (multifreq
) motif format described here.
Two scanning-related functions are provided: scan_sequences()
and enrich_motifs()
. The latter simply runs scan_sequences()
twice on a set of target and background sequences. Given a motif of length n
, scan_sequences()
considers every possible n
-length subset in a sequence and scores it using the PWM format. If the match surpasses the minimum threshold, it is reported. This is case regardless of whether one is scanning with a regular motif, or using the higher-order (multifreq
) motif format (the multifreq
matrix is converted to a PWM).
Before scanning a set of sequences, one must first decide the minimum logodds threshold for retrieving matches. This decision is not always the same between scanning programs out in the wild, nor is it usually told to the user what the cutoff is or how it is decided. As a result, universalmotif
aims to be as transparent as possible in this regard by allowing for complete control of the threshold. For more details on PWMs, see the introductory vignette.
One way is to set a cutoff between 0 and 1, then multiplying the highest possible PWM score to get a threshold. The matchPWM()
function from the Biostrings
package for example uses a default of 0.8 (shown as "80%"
). This is quite arbitrary of course, and every motif will end up with a different threshold. For high information content motifs, there is really no right or wrong threshold, as they tend to have fewer non-specific positions. This means that incorrect letters in a match will be more punishing. To illustrate this, contrast the following PWMs:
library(universalmotif) m1 <- create_motif("TATATATATA", nsites = 50, type = "PWM", pseudocount = 1) m2 <- matrix(c(0.10,0.27,0.23,0.19,0.29,0.28,0.51,0.12,0.34,0.26, 0.36,0.29,0.51,0.38,0.23,0.16,0.17,0.21,0.23,0.36, 0.45,0.05,0.02,0.13,0.27,0.38,0.26,0.38,0.12,0.31, 0.09,0.40,0.24,0.30,0.21,0.19,0.05,0.30,0.31,0.08), byrow = TRUE, nrow = 4) m2 <- create_motif(m2, alphabet = "DNA", type = "PWM") m1["motif"] m2["motif"]
In the first example, sequences which do not have a matching base in every position are punished heavily. The maximum logodds score in this case is approximately 20, and for each incorrect position the score is reduced approximately by 5.7. This means that a threshold of zero would allow for at most three mismatches. At this point, it is up to you how many mismatches you would deem appropriate.
This thinking becomes impossible for the second example. In this case, mismatches are much less punishing, to the point that one could ask: what even constitutes a mismatch? The answer to this question is usually much more difficult in such cases. An alternative to manually deciding upon a threshold is to instead start with maximum P-value one would consider appropriate for a match. If, say, we want matches with a P-value of at most 0.001, then we can use motif_pvalue()
to calculate the appropriate threshold (see the comparisons and P-values vignette for details on motif P-values).
motif_pvalue(m2, pvalue = 0.001)
This P-value can be further refined to correct for multiple testing (and becomes a Q-value). There are three available corrections that can be set in scan_sequences()
: Bonferroni ("bonferroni"), Benjamini & Hochberg ("BH"), and the false discovery rate ("fdr") based on the empirical null distribution of motif hits in a set of sequences. They are excellently explained in @noble09, and these explanations will be briefly regurgitated here.
To begin to understand how these different corrections are implemented, consider the following motif, sequences, example P-value for an example motif hit, and the theoretical maximum number of motif hits:
library(universalmotif) data(ArabidopsisMotif) data(ArabidopsisPromoters) (Example.Score <- score_match(ArabidopsisMotif, "TTCTCTTTTTTTTTT")) (Example.Pvalue <- motif_pvalue(ArabidopsisMotif, Example.Score)) (Max.Possible.Hits <- sum(width(ArabidopsisPromoters) - ncol(ArabidopsisMotif) + 1))
The first correction method, Bonferroni, is by far the simplest. To calculate it, take the P-value of a motif hit and multiply it by the theoretical maximum number of hits:
(Example.bonferroni <- Example.Pvalue * Max.Possible.Hits)
As you can imagine, the level of punishment the P-value receives corresponds to the size of the sequences you are scanning. If you are scanning an entire genome, then you can expect this to be very punishing and only return near-perfect matches (or no matches). However for smaller sets of sequences this correction can be more appropriate.
Next, Benjamini & Hochberg. To perform this correction, the P-value is divided by the percentile rank of the P-value in the list of P-values for all theoretically possible hits sorted in ascending order (it also assumes that P-values are normally distributed under the null hypothesis). It is important to note that this means the correction cannot be calculated before the sequences have been scanned for the motif, and P-values have been calculated for all returned hits. When requesting this type of Q-value for the minimum threshold of score, scan_sequences()
instead calculates the threshold from the input Q-value as a P-value, then filters the final results after Q-values have been calculated. Returning to our example:
(Scan.Results <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters, threshold = 0.8, threshold.type = "logodds", calc.qvals = FALSE))
First we sort and calculate the percentile ranks of our P-values, and then divide the P-values:
Pvalues <- Scan.Results$pvalue Pvalues.Ranks <- (rank(Pvalues) / Max.Possible.Hits) * 100 Qvalues.BH <- Pvalues / Pvalues.Ranks (Example.BH <- Qvalues.BH[Scan.Results$match == "TTCTCTTTTTTTTTT"][1])
Finally, calculating the false discovery rate from the empirical distribution of scores. This method requires some additional steps, as we must obtain the observed and null distributions of hits in our sequences. Then for each hit, divide the number of hits with a score equal to or greater in the null distribution with the number of hits with a score equal to or greater in the observed distribution. Along the way we must be wary of the nonmonotonicity of the final Q-values (meaning that as scores get smaller the Q-value does not always increase), and thus always select the minimum available Q-value as the score increases. To get the null distribution of hits, we can simply use the P-values associated with each score as these are analytically calculated from the null based on the background probabilities (see ?motif_pvalue
).
Scan.Results <- Scan.Results[order(Scan.Results$score, decreasing = TRUE), ] Observed.Hits <- 1:nrow(Scan.Results) Null.Hits <- Max.Possible.Hits * Scan.Results$pvalue Qvalues.fdr <- Null.Hits / Observed.Hits Qvalues.fdr <- rev(cummin(rev(Qvalues.fdr))) (Example.fdr <- Qvalues.fdr[Scan.Results$match == "TTCTCTTTTTTTTTT"][1])
Similarly to Benjamini & Hochberg, these can only be known after scanning has occurred.
To summarize, we can compare the initial P-value with the different corrections:
knitr::kable( data.frame( What = c("Score", "P-value", "bonferroni", "BH", "fdr"), Value = format( c(Example.Score, Example.Pvalue, Example.bonferroni, Example.BH, Example.fdr), scientific = FALSE ) ), format = "markdown", caption = "Comparing P-value correction methods" )
Use your best judgement as to which method is most appropriate for your specific use case.
Furthermore, the scan_sequences()
function offers the ability to scan using the multifreq
slot, if available. This allows to take into account inter-positional dependencies, and get matches which more faithfully represent the original sequences from which the motif originated.
library(universalmotif) library(Biostrings) data(ArabidopsisPromoters) ## A 2-letter example: motif.k2 <- create_motif("CWWWWCC", nsites = 6) sequences.k2 <- DNAStringSet(rep(c("CAAAACC", "CTTTTCC"), 3)) motif.k2 <- add_multifreq(motif.k2, sequences.k2)
Regular scanning:
scan_sequences(motif.k2, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds")
Using 2-letter information to scan:
scan_sequences(motif.k2, ArabidopsisPromoters, use.freq = 2, RC = TRUE, threshold = 0.9, threshold.type = "logodds")
Furthermore, sequence scanning can be further refined to avoid overlapping hits. Consider:
motif <- create_motif("AAAAAA") ## Leave in overlapping hits: scan_sequences(motif, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds") ## Only keep the highest scoring hit amongst overlapping hits: scan_sequences(motif, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds", no.overlaps = TRUE)
Finally, the results can be returned as a GRanges
object for further manipulation:
scan_sequences(motif.k2, ArabidopsisPromoters, RC = TRUE, threshold = 0.9, threshold.type = "logodds", return.granges = TRUE)
A few suggestions for different ways of plotting hits across sequences are presented here.
Using the ggbio
package, it is rather trivial to generate nice visualizations of the output of scan_sequences()
. This requires having the GenomicRanges
and ggbio
packages installed, and outputting the scan_sequences()
result as a GRanges
object (via return.granges = TRUE
).
library(universalmotif) library(GenomicRanges) library(ggbio) data(ArabidopsisPromoters) motif1 <- create_motif("AAAAAA", name = "Motif A") motif2 <- create_motif("CWWWWCC", name = "Motif B") res <- scan_sequences(c(motif1, motif2), ArabidopsisPromoters[1:10], return.granges = TRUE, calc.pvals = TRUE, no.overlaps = TRUE, threshold = 0.2, threshold.type = "logodds") ## Just plot the motif hits: autoplot(res, layout = "karyogram", aes(fill = motif, color = motif)) + theme( strip.background = element_rect(fill = NA, colour = NA), panel.background = element_rect(fill = NA, colour = NA) ) ## Plot Motif A hits by P-value: autoplot(res[res$motif.i == 1, ], layout = "karyogram", aes(fill = log10(pvalue), colour = log10(pvalue))) + scale_fill_gradient(low = "black", high = "grey75") + scale_colour_gradient(low = "black", high = "grey75") + theme( strip.background = element_rect(fill = NA, colour = NA), panel.background = element_rect(fill = NA, colour = NA) )
Alternatively, just a simple heatmap with only ggplot2
.
library(universalmotif) library(ggplot2) data(ArabidopsisMotif) data(ArabidopsisPromoters) res <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters, threshold = 0, threshold.type = "logodds.abs") res <- suppressWarnings(as.data.frame(res)) res$x <- mapply(function(x, y) mean(c(x, y)), res$start, res$stop) ggplot(res, aes(x, sequence, fill = score)) + scale_fill_viridis_c() + scale_x_continuous(expand = c(0, 0)) + xlim(0, 1000) + xlab(element_blank()) + ylab(element_blank()) + geom_tile(width = ncol(ArabidopsisMotif)) + theme_bw() + theme(panel.grid = element_blank(), axis.text.y = element_text(size = 6))
Using packages such as ggExtra
or ggpubr
, one could even plot marginal histogram or density plots above or below to illustrate any motif positional preference within the sequences. (Though keep in mind that the hit coordinates and sequence lengths would need to be normalized if not all sequences were of the same length, as they are here.)
Finally, the distribution of all possible motif scores could be shown as a line plot across the sequences.
library(universalmotif) library(ggplot2) data(ArabidopsisMotif) data(ArabidopsisPromoters) res <- scan_sequences(ArabidopsisMotif, ArabidopsisPromoters[1:5], threshold = -Inf, threshold.type = "logodds.abs") res <- suppressWarnings(as.data.frame(res)) res$position <- mapply(function(x, y) mean(c(x, y)), res$start, res$stop) ggplot(res, aes(position, score, colour = score)) + geom_line() + geom_hline(yintercept = 0, colour = "red", alpha = 0.3) + theme_bw() + scale_colour_viridis_c() + facet_wrap(~sequence, ncol = 1) + xlab(element_blank()) + ylab(element_blank()) + theme(strip.background = element_blank())
The universalmotif
package offers the ability to search for enriched motif sites in a set of sequences via enrich_motifs()
. There is little complexity to this, as it simply runs scan_sequences()
twice: once on a set of target sequences, and once on a set of background sequences. After which the results between the two sequences are collated and run through enrichment tests. The background sequences can be given explicitly, or else enrich_motifs()
will create background sequences on its own by using shuffle_sequences()
on the target sequences.
Let us consider the following basic example:
library(universalmotif) data(ArabidopsisMotif) data(ArabidopsisPromoters) enrich_motifs(ArabidopsisMotif, ArabidopsisPromoters, shuffle.k = 3, threshold = 0.001, RC = TRUE)
Here we can see that the motif is significantly enriched in the target sequences. The Pval
was calculated by calling stats::fisher.test()
.
One final point: always keep in mind the threshold
parameter, as this will ultimately decide the number of hits found. (A bad threshold can lead to a false negative.)
universalmotif
class motifs can be gapped, which can be used by scan_sequences()
and enrich_motifs()
. Note that gapped motif support is currently limited to these two functions. All other functions will ignore the gap information, and even discard them in functions such as merge_motifs()
.
First, obtain the component motifs:
library(universalmotif) data(ArabidopsisPromoters) m1 <- create_motif("TTTATAT", name = "PartA") m2 <- create_motif("GGTTCGA", name = "PartB")
Then, combine them and add the desired gap. In this case, a gap will be added between the two motifs which can range in size from 4-6 bases.
m <- cbind(m1, m2) m <- add_gap(m, gaploc = ncol(m1), mingap = 4, maxgap = 6) m
Now, it can be used directly in scan_sequences()
or enrich_motifs()
:
scan_sequences(m, ArabidopsisPromoters, threshold = 0.4, threshold.type = "logodds")
Highly-repetitive low complexity regions can oftentimes cause problems during de novo motif discovery, leading to obviously false motifs being returned. One way to get around this issue is to preemptively remove or mask these regions. The universalmotif
package includes a few functions which can help carry out this task.
Using mask_seqs()
, one can mask a specific pattern of letters in XStringSet
objects. Consider the following sequences:
library(universalmotif) library(Biostrings) Ex.seq <- DNAStringSet(c( A = "GTTGAAAAAAAAAAAAAAAACAGACGT", B = "TTAGATGGCCCATAGCTTATACGGCAA", C = "AATAAAATGCTTAGGAAATCGATTGCC" ))
We can easily mask portions that contain, say, stretches of at least 8 A
s:
mask_seqs(Ex.seq, "AAAAAAAA")
Alternatively, instead of masking a know stretch of letters one can find low complexity regions using sequence_complexity()
, and then mask specific regions in the sequences using mask_ranges()
. The sequence_complexity()
function has several complexity metrics available: the Wootton-Federhen [@wootton93] and Trifonov [@trifonov90] algorithms (and their approximations) are well described in @orlov04, and DUST in @morgulis06. See ?sequence_complexity
for more details.
(Ex.DUST <- sequence_complexity(Ex.seq, window.size = 10, method = "DUST", return.granges = TRUE))
Using the DUST algorithm, we can see there are a couple of regions which spike in the complexity score (for this particular algorithm, more complex sequences converge towards zero). Now it is only a matter of filtering for those regions and using mask_ranges()
.
(Ex.DUST <- Ex.DUST[Ex.DUST$complexity >= 3]) mask_ranges(Ex.seq, Ex.DUST)
Now these sequences could be used directly with scan_sequences()
or written to a fasta file using Biostrings::writeXStringSet()
for use with an external de novo motif discovery program such as MEME.
Note: In the time since the inception of the run_meme()
function, Spencer Nystrom (a contributor to universalmotif
) has created the memes
package as a interface to much of the MEME
suite. It is fully interoperable with the universalmotif
package and provides a much more convenient way to run MEME
programs from within R
. Install it from Bioconductor with BiocManager::install("memes")
.
The universalmotif
package provides a simple wrapper to the powerful motif discovery tool MEME
[@meme3]. To run an analysis with MEME
, all that is required is a set of XStringSet
class sequences (defined in the Biostrings
package), and run_meme()
will take care of running the program and reading the output for use within R
.
The first step is to check that R can find the MEME
binary in your $PATH
by running run_meme()
without any parameters. If successful, you should see the default MEME
help message in your console. If not, then you'll need to provide the complete path to the MEME
binary. There are two options:
library(universalmotif) ## 1. Once per session: via `options()` options(meme.bin = "/path/to/meme/bin/meme") run_meme(...) ## 2. Once per run: via `run_meme()` run_meme(..., bin = "/path/to/meme/bin/meme")
Now we need to get some sequences to use with run_meme()
. At this point we can read sequences from disk or extract them from one of the Bioconductor
BSgenome
packages.
library(universalmotif) data(ArabidopsisPromoters) ## 1. Read sequences from disk (in fasta format): library(Biostrings) # The following `read*()` functions are available in Biostrings: # DNA: readDNAStringSet # DNA with quality scores: readQualityScaledDNAStringSet # RNA: readRNAStringSet # Amino acid: readAAStringSet # Any: readBStringSet sequences <- readDNAStringSet("/path/to/sequences.fasta") run_meme(sequences, ...) ## 2. Extract from a `BSgenome` object: library(GenomicFeatures) library(TxDb.Athaliana.BioMart.plantsmart28) library(BSgenome.Athaliana.TAIR.TAIR9) # Let us retrieve the same promoter sequences from ArabidopsisPromoters: gene.names <- names(ArabidopsisPromoters) # First get the transcript coordinates from the relevant `TxDb` object: transcripts <- transcriptsBy(TxDb.Athaliana.BioMart.plantsmart28, by = "gene")[gene.names] # There are multiple transcripts per gene, we only care for the first one # in each: transcripts <- lapply(transcripts, function(x) x[1]) transcripts <- unlist(GRangesList(transcripts)) # Then the actual sequences: # Unfortunately this is a case where the chromosome names do not match # between the two databases seqlevels(TxDb.Athaliana.BioMart.plantsmart28) #> [1] "1" "2" "3" "4" "5" "Mt" "Pt" seqlevels(BSgenome.Athaliana.TAIR.TAIR9) #> [1] "Chr1" "Chr2" "Chr3" "Chr4" "Chr5" "ChrM" "ChrC" # So we must first rename the chromosomes in `transcripts`: seqlevels(transcripts) <- seqlevels(BSgenome.Athaliana.TAIR.TAIR9) # Finally we can extract the sequences promoters <- getPromoterSeq(transcripts, BSgenome.Athaliana.TAIR.TAIR9, upstream = 1000, downstream = 0) run_meme(promoters, ...)
Once the sequences are ready, there are few important options to keep in mind. One is whether to conserve the output from MEME
. The default is not to, but this can be changed by setting the relevant option:
run_meme(sequences, output = "/path/to/desired/output/folder")
The second important option is the search function (objfun
). Some search functions such as the default classic
do not require a set of background sequences, whilst some do (such as de
). If you choose one of the latter, then you can either let MEME
create them for you (it will shuffle the target sequences) or you can provide them via the control.sequences
parameter.
Finally, choose how you'd like the data imported into R
. Once the MEME
program exits, run_meme()
will import the results into R
with read_meme()
. At this point you can decide if you want just the motifs themselves (readsites = FALSE
) or if you'd like the original sequence sites as well (readsites = TRUE
, the default). Doing the latter gives you the option of generating higher order representations for the imported MEME
motifs as shown here:
motifs <- run_meme(sequences) motifs.k23 <- mapply(add_multifreq, motifs$motifs, motifs$sites)
There are a wealth of other MEME
options available, such as the number of desired motifs (nmotifs
), the width of desired motifs (minw
, maxw
), the search mode (mod
), assigning sequence weights (weights
), using a custom alphabet (alph
), and many others. See the output from run_meme()
for a brief description of the options, or visit the online manual for more details.
Since biological sequences are usually contained in XStringSet
class objects, sequence_complexity()
, get_bkg()
and shuffle_sequences()
are designed to work with such objects. For cases when strings are not XStringSet
objects, the following functions are available:
calc_complexity()
: alternative to sequence_complexity()
count_klets()
: alternative to get_bkg()
shuffle_string()
: alternative to shuffle_sequences()
library(universalmotif) string <- "DASDSDDSASDSSA" calc_complexity(string) count_klets(string, 2) shuffle_string(string, 2)
A few other utilities have also been made available (based on the internal code of other universalmotif
functions) that work on simple character vectors:
calc_windows()
: calculate the coordinates for sliding windows from 1 to any number n
get_klets()
: get a list of all possible k
-lets for any sequence alphabetslide_fun()
: apply a function over sliding windows across a single stringwindow_string()
: retrieve characters from sliding windows of a single stringlibrary(universalmotif) calc_windows(n = 12, window = 4, overlap = 2) get_klets(c("A", "S", "D"), 2) slide_fun("ABCDEFGH", charToRaw, raw(2), window = 2, overlap = 1) window_string("ABCDEFGH", window = 2, overlap = 1)
sessionInfo()
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.