skewer: Running skewer, an adapter trimmer application, Jiang et al...

Description Usage Arguments Value Author(s) Examples

View source: R/skewer.R

Description

This function executes the docker container skewer1 to remove sequencing adapters from RNAseq reads

Usage

1
2
3
skewer(group = c("sudo", "docker"), fastq.folder = getwd(),
  scratch.folder = "/data/scratch", adapter5, adapter3,
  seq.type = c("se", "pe"), threads = 1, min.length = 18)

Arguments

group,

a character string. Two options: "sudo" or "docker", depending to which group the user belongs

fastq.folder,

a character string indicating where gzip fastq files are located

scratch.folder,

a character string indicating the scratch folder where docker container will be mounted

adapter5,

a character string indicating the fwd adapter

adapter3,

a character string indicating the rev adapter

seq.type,

a character string indicating the type of reads to be trimmed. Two options: "se" or "pe" respectively for single end and pair end sequencing.

threads,

a number indicating the number of cores to be used from the application

min.length,

a number indicating minimal length required to return a trimmed read

Value

One or two gzip fastq files ending with trimmed-pair1.fastq.gz and trimmed-pair1.fastq.gz, a log file of the trimming with the extensione trimmed.log, run.info file descring the analysis steps done by the docker. The latter file is useful to understand where the docker stop in case of unexpected end

Author(s)

Raffaele Calogero

Examples

1
2
3
4
5
6
7
8
9
## Not run: 
    system("wget http://130.192.119.59/public/test_R1.fastq.gz")
    system("wget http://130.192.119.59/public/test_R2.fastq.gz")
    skewer(group="docker",fastq.folder=getwd(), scratch.folder="/data/scratch",
    adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
    adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
    seq.type="pe", threads=10,  min.length=40)

## End(Not run)

kendomaniac/docker4seq documentation built on Dec. 16, 2018, 2:14 p.m.