wrapperSalmon: A function to estimate counts using Salmon quasi-alignment

Description Usage Arguments Author(s) Examples

View source: R/wrapperSalmon.R


This function executes a docker that produces as output the transcripts count file generated by Salmon quasi-alignment and convert it the same format of isoforms.result of RSEM


wrapperSalmon(group = c("sudo", "docker"), scratch.folder, fastq.folder,
  index.folder, threads = 24, seq.type = c("se", "pe"), adapter5,
  adapter3, min.length, strandness = c("none", "forward", "reverse"))



a character string. Two options: sudo or docker, depending to which group the user belongs


a character string indicating the path of the scratch folder


a character string indicating the folder where input data are located and where output will be written


a character string indicating the folder where transcriptome index was created with salmonIndex.


a number indicating the number of cores to be used from the application


a character string indicating the type of reads to be generated by the sequencer. Two options: "se" or "pe" respectively for single end and pair end sequencing. Strandness is inferred by salmon.


a character string indicating the fwd adapter


a character string indicating the rev adapter


a number indicating minimal length required to return a trimmed read


a character string indicating the type ofsequencing protocol used for the analysis. Three options: "none", "forward", "reverse" respectively for non strand selection, reverse for Illumina strandness protocols, reverse for ACCESS Illumina protocol


Raffaele Calogero, raffaele.calogero [at] unito [dot] it, Bioinformatics and Genomics unit, University of Torino Italy


## Not run: 
#running salmonCounts
wrapperSalmon(group="docker", scratch.folder="/scratch/users/rcaloger/",
        fastq.folder=getwd(), index.folder="/archive/home/rcaloger/data/seqbox/salmonIndex.R",
        threads=24, seq.type="pe", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
        adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", min.length=40, strandness="none")

## End(Not run)

kendomaniac/docker4seq documentation built on Jan. 21, 2019, 5:45 a.m.