DesignArray: Design a Set of DNA Microarray Probes for Detecting Sequences

In DECIPHER: Tools for curating, analyzing, and manipulating biological sequences

Description

Chooses the set of microarray probes maximizing sensitivity and specificity to each target consensus sequence.

Usage

DesignArray(myDNAStringSet,
            maxProbeLength = 24,
            minProbeLength = 20,
            maxPermutations = 4,
            numRecordedMismatches = 500,
            numProbes = 10,
            start = 1,
            end = NULL,
            maxOverlap = 5,
            hybridizationFormamide = 10,
            minMeltingFormamide = 15,
            maxMeltingFormamide = 20,
            minScore = -1e+12,
            processors = 1,
            verbose = TRUE)

Arguments

myDNAStringSet	A DNAStringSet object of aligned consensus sequences.
maxProbeLength	The maximum length of probes, not including the poly-T spacer. Ideally less than 27 nucleotides.
minProbeLength	The minimum length of probes, not including the poly-T spacer. Ideally more than 18 nucleotides.
maxPermutations	The maximum number of probe permutations required to represent a target site. For example, if a target site has an 'N' then 4 probes are required because probes cannot be ambiguous. Typically fewer permutations are preferably because this requires less space on the microarray and simplifies interpretation of the results.
numRecordedMismatches	The maximum number of recorded potential cross-hybridizations for any target site.
numProbes	The target number of probes on the microarray per input consensus sequence.
start	Integer specifying the starting position in the alignment where potential forward primer target sites begin. Preferably a position that is included in most sequences in the alignment.
end	Integer specifying the ending position in the alignment where potential reverse primer target sites end. Preferably a position that is included in most sequences in the alignment.
maxOverlap	Maximum overlap in nucleotides between target sites on the sequence.
hybridizationFormamide	The formamide concentration (%, vol/vol) used in hybridization at 42 degrees Celsius. Note that this concentration is used to approximate hybridization efficiency of cross-amplifications.
minMeltingFormamide	The minimum melting point formamide concentration (%, vol/vol) of the designed probes. The melting point is defined as the concentration where half of the template is bound to probe.
maxMeltingFormamide	The maximum melting point formamide concentration (%, vol/vol) of the designed probes. Must be greater than the minMeltingFormamide.
minScore	The minimum score of designed probes before exclusion. A greater minScore will accelerate the code because more target sites will be excluded from consideration. However, if the minScore is too high it will prevent any target sites from being recorded.
processors	The number of processors to use, or NULL to automatically detect and use all available processors.
verbose	Logical indicating whether to display progress.

Details

The algorithm begins by determining the optimal length of probes required to meet the input constraints while maximizing sensitivity to the target consensus sequence at the specified hybridization formamide concentration. This set of potential target sites is then scored based on the possibility of cross-hybridizing to the other non-target sequences. The set of probes is returned with the minimum possibility of cross-hybridizing.

Value

A data.frame with the optimal set of probes matching the specified constraints. Each row lists the probe's target sequence (name), start position, length in nucleotides, start and end position in the sequence alignment, number of permutations, score, melt point in percent formamide at 42 degrees Celsius, hybridization efficiency (hyb_eff), target site, and probe(s). Probes are designed such that the stringency is determined by the equilibrium hybridization conditions and not subsequent washing steps.

Author(s)

Erik Wright [e-mail]

References

ES Wright et al. (2013) Identification of Bacterial and Archaeal Communities From Source to Tap. Water Research Foundation, Denver, CO.

DR Noguera, et al. (2014). Mathematical tools to optimize the design of oligonucleotide probes and primers. Applied Microbiology and Biotechnology. doi:10.1007/s00253-014-6165-x.

See Also

Array2Matrix, NNLS

Examples

fas <- system.file("extdata", "Bacteria_175seqs.fas", package="DECIPHER")
dna <- readDNAStringSet(fas)
names(dna) <- 1:length(dna)
probes <- DesignArray(dna)
probes[1,]

Example output

Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: ‘BiocGenerics’

The following objects are masked from ‘package:parallel’:

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from ‘package:stats’:

    IQR, mad, sd, var, xtabs

The following objects are masked from ‘package:base’:

    anyDuplicated, append, as.data.frame, basename, cbind, colnames,
    dirname, do.call, duplicated, eval, evalq, Filter, Find, get, grep,
    grepl, intersect, is.unsorted, lapply, Map, mapply, match, mget,
    order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
    rbind, Reduce, rownames, sapply, setdiff, sort, table, tapply,
    union, unique, unsplit, which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: ‘S4Vectors’

The following object is masked from ‘package:base’:

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: ‘Biostrings’

The following object is masked from ‘package:base’:

    strsplit

Loading required package: RSQLite
================================================================================
Time difference of 5.52 secs

  name start length start_aligned end_aligned permutations        score
1    1   550     24           661         686            1 92.60820....
     formamide      hyb_eff              target_site
1 16.31348.... 85.13890.... GTCATTGGAAACTGGGAGACTTGA
                                        probes mismatches
1 TCAAGTCTCCCAGTTTCCAATGACTTTTTTTTTTTTTTTTTTTT   4 (0.8%)

DECIPHER documentation built on Nov. 8, 2020, 8:30 p.m.