CalculateEfficiencyFISH: Predict Thermodynamic Parameters of Probe/Target Sequence...

In DECIPHER: Tools for curating, analyzing, and manipulating biological sequences

Description

Calculates the Gibbs free energy, formamide melt point, and hybridization efficiency of probe/target (DNA/RNA) pairs.

Usage

CalculateEfficiencyFISH(probe,
                        target,
                        temp,
                        P,
                        ions,
                        FA,
                        batchSize = 1000)

Arguments

probe	A DNAStringSet object or character vector with unaligned probe sequences in 5' to 3' orientation.
target	A DNAStringSet object, RNAStringSet, or character vector with unaligned target or non-target sequences in 5' to 3' orientation. The DNA base Thymine will be treated the same as Uracil.
temp	Numeric specifying the hybridization temperature, typically 46 degrees Celsius.
P	Numeric giving the molar concentration of probes during hybridization.
ions	Numeric giving the molar sodium equivalent ionic concentration. Values may range between 0.01M and 1M. Note that salt correction is not available for thermodynamic rules of RNA/RNA interactions, which were determined at 1 molar concentration.
FA	Numeric concentration (as percent v/v) of the denaturant formamide in the hybridization buffer.
batchSize	Integer specifying the number of probes to simulate hybridization per batch. See the Description section below.

Details

Hybridization of pairwise probe/target (DNA/RNA) pairs is simulated in silico. Gibbs free energies are obtained from system calls to OligoArrayAux, which must be properly installed (see the Notes section below). Probe/target pairs are sent to OligoArrayAux in batches of batchSize, which prevents systems calls from being too many characters. Note that OligoArrayAux does not support degeneracy codes (non-base letters), although they are accepted without error. Any sequences with ambiguity should be expanded into multiple permutations with Disambiguate before input.

Value

A matrix of predicted hybridization efficiency (HybEff), formamide melt point (FAm), and free energy (ddG1 and dG1) for each probe/target pair of sequences.

Note

The program OligoArrayAux (http://mfold.rna.albany.edu/?q=DINAMelt/OligoArrayAux) must be installed in a location accessible by the system. For example, the following code should print the installed OligoArrayAux version when executed from the R console:

system("hybrid-min -V")

Author(s)

Erik Wright [e-mail]

References

ES Wright et al. (2014) "Automated Design of Probes for rRNA-Targeted Fluorescence In Situ Hybridization Reveals the Advantages of Using Dual Probes for Accurate Identification." Applied and Environmental Microbiology, doi:10.1128/AEM.01685-14.

See Also

DesignProbes, TileSeqs

Examples

probe <- c("GGGCTTTCACATCAGACTTAAGAAACC", "CCCCACGCTTTCGCGCC")
target <- reverseComplement(DNAStringSet(probe))
# not run (must have OligoArrayAux installed first):
## Not run: CalculateEfficiencyFISH(probe, target, temp=46, P=250e-9, ions=1, FA=35)

Example output

Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: ‘BiocGenerics’

The following objects are masked from ‘package:parallel’:

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from ‘package:stats’:

    IQR, mad, sd, var, xtabs

The following objects are masked from ‘package:base’:

    anyDuplicated, append, as.data.frame, basename, cbind, colnames,
    dirname, do.call, duplicated, eval, evalq, Filter, Find, get, grep,
    grepl, intersect, is.unsorted, lapply, Map, mapply, match, mget,
    order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
    rbind, Reduce, rownames, sapply, setdiff, sort, table, tapply,
    union, unique, unsplit, which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: ‘S4Vectors’

The following object is masked from ‘package:base’:

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: ‘Biostrings’

The following object is masked from ‘package:base’:

    strsplit

Loading required package: RSQLite

DECIPHER documentation built on Nov. 8, 2020, 8:30 p.m.