CalculateEfficiencyPCR: Predict Amplification Efficiency of Primer Sequences

In DECIPHER: Tools for curating, analyzing, and manipulating biological sequences

Description

Calculates the amplification efficiency of primers from their hybridization efficiency and elongation efficiency at the target site.

Usage

CalculateEfficiencyPCR(primer,
                       target,
                       temp,
                       P,
                       ions,
                       batchSize = 1000,
                       taqEfficiency = TRUE,
                       maxDistance = 0.4,
                       maxGaps = 2,
                       processors = 1)

Arguments

primer	A DNAStringSet object or character vector with unaligned primer sequences in 5' to 3' orientation.
target	A DNAStringSet object or character vector with unaligned target or non-target sequences in 5' to 3' orientation.
temp	Numeric specifying the annealing temperature used in the PCR reaction.
P	Numeric giving the molar concentration of primers in the reaction.
ions	Numeric giving the molar sodium equivalent ionic concentration. Values may range between 0.01M and 1M.
batchSize	Integer specifying the number of primers to simulate hybridization per batch. See the Description section below.
taqEfficiency	Logical determining whether to make use of elongation efficiency and maxDistance to increase predictive accuracy for Taq DNA Polymerase amplifying primers with mismatches near the 3' terminus. Note that this should be set to FALSE if using a high-fidelity polymerase with 3' to 5' exonuclease activity.
maxDistance	Numeric specifying the maximal fraction of mismatched base pairings on a rolling basis beginning from the 3' end of the primer. Only used if taqEfficiency is TRUE.
maxGaps	Integer specifying the maximum number of insertions or deletions (indels) in the primer/target alignment. Only used if taqEfficiency is TRUE.
processors	The number of processors to use, or NULL to automatically detect and use all available processors.

Details

Amplification of pairwise primer/target pairs is simulated in silico. A complex model of hybridization is employed that takes into account the side reactions resulting from probe-folding, target-folding, and primer-dimer formation. The resulting hybridization efficiency is multiplied by the elongation efficiency to predict the overall efficiency of amplification.

Free energy is obtained from system calls to OligoArrayAux, which must be properly installed (see the Notes section below). Primer/target pairs are sent to OligoArrayAux in batches of batchSize, which prevents systems calls from being too many characters. Note that OligoArrayAux does not support degeneracy codes (non-base letters), although they are accepted without error. Any sequences with ambiguity should be expanded into multiple permutations with Disambiguate before input.

Value

A vector of predicted efficiencies for amplifying each primer/target pair of sequences.

Note

The program OligoArrayAux (http://mfold.rna.albany.edu/?q=DINAMelt/OligoArrayAux) must be installed in a location accessible by the system. For example, the following code should print the installed OligoArrayAux version when executed from the R console:

system("hybrid-min -V")

Author(s)

Erik Wright [e-mail]

References

ES Wright et al. (2013) "Exploiting Extension Bias in PCR to Improve Primer Specificity in Ensembles of Nearly Identical DNA Templates." Environmental Microbiology, doi:10.1111/1462-2920.12259.

See Also

AmplifyDNA, DesignPrimers, DesignSignatures

Examples

primers <- c("AAAAACGGGGAGCGGGGGG", "AAAAACTCAACCCGAGGAGCGCGT")
targets <- reverseComplement(DNAStringSet(primers))
# not run (must have OligoArrayAux installed first):
## Not run: CalculateEfficiencyPCR(primers, targets, temp=75, P=4e-7, ions=0.225)

Example output

Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colMeans, colSums, colnames, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
    pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
    setdiff, sort, table, tapply, union, unique, unsplit, which,
    which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

Loading required package: RSQLite

DECIPHER documentation built on Nov. 8, 2020, 8:30 p.m.