Nothing
################ Internal Functions ################
Internal.convertProb <- function(value, base, param, prob, weight) {
for(idx in 1:10) {
if(value >= param[idx]) {
probRes <- prob[[base]][[idx]] * weight[[base]]
break
}
}
probRes
}
Internal.FickettScore <- function(oneSeq, .positionProb, .positionWeight,
.positionParam, .contentProb,
.contentWeight, .contentParam) {
countSeq <- seqinr::count(oneSeq, wordsize = 1, freq = TRUE)
lenSeq <- length(oneSeq)
phase1 <- oneSeq[seq(1, lenSeq, 3)]
phase2 <- oneSeq[seq(2, lenSeq, 3)]
phase3 <- oneSeq[seq(3, lenSeq, 3)]
position.a <- max(sum(phase1 == "a"), sum(phase2 == "a"), sum(phase3 == "a")) / (min(sum(phase1 == "a"), sum(phase2 == "a"), sum(phase3 == "a")) + 1)
position.c <- max(sum(phase1 == "c"), sum(phase2 == "c"), sum(phase3 == "c")) / (min(sum(phase1 == "c"), sum(phase2 == "c"), sum(phase3 == "c")) + 1)
position.g <- max(sum(phase1 == "g"), sum(phase2 == "g"), sum(phase3 == "g")) / (min(sum(phase1 == "g"), sum(phase2 == "g"), sum(phase3 == "g")) + 1)
position.t <- max(sum(phase1 == "t"), sum(phase2 == "t"), sum(phase3 == "t")) / (min(sum(phase1 == "t"), sum(phase2 == "t"), sum(phase3 == "t")) + 1)
contentProb.a <- Internal.convertProb(value = countSeq["a"], base = "a", param = .contentParam, prob = .contentProb, weight = .contentWeight)
contentProb.c <- Internal.convertProb(value = countSeq["c"], base = "c", param = .contentParam, prob = .contentProb, weight = .contentWeight)
contentProb.g <- Internal.convertProb(value = countSeq["g"], base = "g", param = .contentParam, prob = .contentProb, weight = .contentWeight)
contentProb.t <- Internal.convertProb(value = countSeq["t"], base = "t", param = .contentParam, prob = .contentProb, weight = .contentWeight)
positionProb.a <- Internal.convertProb(value = position.a, base = "a", param = .positionParam, prob = .positionProb, weight = .positionWeight)
positionProb.c <- Internal.convertProb(value = position.c, base = "c", param = .positionParam, prob = .positionProb, weight = .positionWeight)
positionProb.g <- Internal.convertProb(value = position.g, base = "g", param = .positionParam, prob = .positionProb, weight = .positionWeight)
positionProb.t <- Internal.convertProb(value = position.t, base = "t", param = .positionParam, prob = .positionProb, weight = .positionWeight)
FickettScore <- sum(contentProb.a, contentProb.c, contentProb.g, contentProb.t,
positionProb.a, positionProb.c, positionProb.g, positionProb.t)
FickettScore
}
Internal.EucDistance <- function(OneSeq, referFreq, k, step, alphabet){
freq.val <- seqinr::count(OneSeq, wordsize = k, by = step, alphabet = alphabet, freq = TRUE)
EucDist.LNC <- sqrt(sum((freq.val - referFreq$ref.lnc) ^ 2))
EucDist.PCT <- sqrt(sum((freq.val - referFreq$ref.cds) ^ 2))
EucDist.Ratio <- EucDist.LNC / EucDist.PCT
distance <- c(EucDist.LNC = EucDist.LNC, EucDist.PCT = EucDist.PCT, EucDist.Ratio = EucDist.Ratio)
distance
}
Internal.LogDistance <- function(OneSeq, referFreq, k, step, alphabet){
count.num <- seqinr::count(OneSeq, wordsize = k, by = step, alphabet = alphabet, freq = FALSE)
freq.val <- count.num / sum(count.num)
lnc.ratio <- freq.val[referFreq$ref.lnc != 0] / referFreq$ref.lnc[referFreq$ref.lnc != 0]
pct.ratio <- freq.val[referFreq$ref.cds != 0] / referFreq$ref.cds[referFreq$ref.cds != 0]
LogDist.LNC <- (sum(log(lnc.ratio[lnc.ratio != 0])) - length(which(lnc.ratio == 0)) + length(which(referFreq$ref.lnc == 0))) / sum(count.num)
LogDist.PCT <- (sum(log(pct.ratio[pct.ratio != 0])) - length(which(pct.ratio == 0)) + length(which(referFreq$ref.cds == 0))) / sum(count.num)
LogDist.Ratio <- LogDist.LNC / LogDist.PCT
distance <- c(LogDist.LNC = LogDist.LNC, LogDist.PCT = LogDist.PCT, LogDist.Ratio = LogDist.Ratio)
distance
}
Internal.hexamerScore <- function(OneSeq, referFreq, k, step, alphabet){
count.num <- seqinr::count(OneSeq, wordsize = k, by = step, alphabet = alphabet, freq = FALSE)
seq.sum <- 0
for(i in names(count.num)[count.num != 0]){
if(referFreq$ref.cds[[i]] != 0 & referFreq$ref.cds[[i]] != 0) {
seq.sum <- seq.sum + (count.num[[i]] * log(referFreq$ref.cds[[i]] / referFreq$ref.cds[[i]]))
} else {
if(referFreq$ref.cds[[i]] == 0) {
seq.sum <- seq.sum - count.num[[i]]
}
if(referFreq$ref.lnc[[i]] == 0) {
seq.sum <- seq.sum + count.num[[i]]
}
}
}
hex.score <- seq.sum / sum(count.num)
hex.score
}
EIIP.DFT <- function(OneSeq) {
OneSeq <- seqinr::getSequence(OneSeq)
OneSeq[!(OneSeq %in% "a" | OneSeq %in% "c" | OneSeq %in% "g" | OneSeq %in% "t")] <- 0
OneSeq[OneSeq %in% "a"] <- 0.1260
OneSeq[OneSeq %in% "c"] <- 0.1340
OneSeq[OneSeq %in% "g"] <- 0.0806
OneSeq[OneSeq %in% "t"] <- 0.1335
numeric.seq <- as.numeric(OneSeq)
fourier.seq <- stats::fft(numeric.seq)
seq.spectrum <- (abs(fourier.seq)) ^ 2
power.length <- length(seq.spectrum)
k <- round(power.length / 3)
DFT.max <- max(seq.spectrum[k-2], seq.spectrum[k-1], seq.spectrum[k],
seq.spectrum[k+1], seq.spectrum[k+2])
total.power <- sum(seq.spectrum) / power.length
SNR.res <- c(Signal.Peak = DFT.max, SNR = (DFT.max / total.power))
seq.spectrum <- seq.spectrum[-c(1, power.length)]
ordered.pow <- sort(seq.spectrum, decreasing = TRUE)
pow.percent <- ordered.pow[1:round(length(ordered.pow) * 0.1)]
Quantile.res <- stats::quantile(pow.percent)[-4]
names(Quantile.res) <- c("Signal.Min", "Signal.Q1", "Signal.Q2", "Signal.Max")
EIIP.res <- c(SNR.res, Quantile.res)
return(EIIP.res)
}
get_EIIP <- function(OneSeq, percent.length = 0.1, probs = seq(0, 1, 0.25)) {
OneSeq[!(OneSeq %in% "a" | OneSeq %in% "c" | OneSeq %in% "g" | OneSeq %in% "t")] <- 0
OneSeq[OneSeq %in% "a"] <- 0.1260
OneSeq[OneSeq %in% "c"] <- 0.1340
OneSeq[OneSeq %in% "g"] <- 0.0806
OneSeq[OneSeq %in% "t"] <- 0.1335
numeric.seq <- as.numeric(OneSeq)
fourier.seq <- stats::fft(numeric.seq)
seq.spectrum <- (abs(fourier.seq)) ^ 2
power.length <- length(seq.spectrum)
k <- round(power.length / 3)
DFT.max <- max(seq.spectrum[k-2], seq.spectrum[k-1], seq.spectrum[k],
seq.spectrum[k+1], seq.spectrum[k+2])
total.power <- sum(seq.spectrum) / power.length
SNR.res <- c(Signal.Peak = DFT.max, Average.Power = total.power, SNR = (DFT.max / total.power))
seq.spectrum <- seq.spectrum[-c(1, power.length)]
ordered.pow <- sort(seq.spectrum, decreasing = TRUE)
pow.percent <- ordered.pow[1:round(length(ordered.pow) * percent.length)]
Quantile.res <- stats::quantile(pow.percent, probs = probs)
EIIP.res <- c(SNR.res, Quantile.res)
return(EIIP.res)
}
fold.res <- function(x, dataset, positive.class, ...) {
subset <- dataset[x, ]
test.set <- dataset[-x, ]
svm.mod <- e1071::svm(label ~ ., data = subset, probability = TRUE, ...)
print(svm.mod)
res <- stats::predict(svm.mod, test.set, probability = TRUE)
confusion.res <- caret::confusionMatrix(data.frame(res)[,1], test.set$label,
positive = positive.class, mode = "everything")
performance.res <- data.frame(Sensitivity = confusion.res$byClass[1],
Specificity = confusion.res$byClass[2],
Accuracy = confusion.res$overall[1],
F.Measure = confusion.res$byClass[7],
Kappa = confusion.res$overall[2])
performance.res
}
get.svm.res <- function(x, index, dataset = dataset){
train.set <- dataset[x,c("label", index)]
test.set <- dataset[-x,]
svm.mod <- e1071::svm(label ~ ., data = train.set, scale = TRUE, probability = TRUE, kernel = "radial")
results <- stats::predict(svm.mod, test.set, probability = TRUE)
conf.res <- caret::confusionMatrix(data.frame(results)[,1], test.set$label,
positive = "lnc", mode = "everything")
perf.res <- data.frame(Sensitivity = conf.res$byClass[1],
Specificity = conf.res$byClass[2],
Accuracy = conf.res$overall[1],
F.Measure = conf.res$byClass[7],
Kappa = conf.res$overall[2])
w.value <- t(svm.mod$coefs) %*% svm.mod$SV
weights <- w.value * w.value
weights <- data.frame(weight = t(weights))
output <- list(perf.res, weights)
output
}
# svm.rfe <- function(dataset, variable.group, save.rank = FALSE, file.path = NULL){
# message("+ Initialization. ", Sys.time())
# message("")
#
# if(is.null(file.path)) file.path <- getwd()
#
# if(save.rank) setwd(file.path)
# variable.group <- c(variable.group, 0)
# variable.group <- unique(variable.group)
# variable.group <- variable.group[which(variable.group < (ncol(dataset) - 1) & variable.group >= 0)]
# variable.group <- sort(variable.group, decreasing = TRUE)
# feature.num <- ncol(dataset)
#
# set.seed(1)
# folds <- caret::createFolds(dataset$label, k = 10, returnTrain = TRUE)
#
# new.fea <- c()
#
# perf.all <- sapply(variable.group, function(variable.number){
#
# varindex <- if(variable.number == max(variable.group)) names(dataset)[-1] else new.fea
# message("+ RFE Processing... Variables: ", length(varindex))
# cl <- parallel::makeCluster(10)
# parallel::clusterExport(cl, varlist = c("dataset", "get.svm.res", "varindex"), envir = environment())
# message("- Training Model... (", Sys.time(), ")")
# svm.res <- parallel::parLapply(cl, folds, get.svm.res, index = varindex)
# parallel::stopCluster(cl)
# message("- Completed. (", Sys.time(), ")")
# message("- Metric:")
#
# perf <- sapply(svm.res, rbind)
# perf <- sapply(perf[1,], cbind)
# perf.convert <- apply(perf, 1, as.numeric)
# print(colMeans(perf.convert))
#
# weights <- svm.res[[1]][[2]]
# for(weight.index in 2:10) {
# weight <- svm.res[[weight.index]][[2]]
# weights <- weights + weight
# }
# weights <- (weights - min(weights)) / (max(weights) - min(weights)) * 100
# sort.index <- sort(weights$weight, decreasing = T, index.return = TRUE)$ix
# weights <- weights[sort.index, , drop = F]
# if(nrow(weights) > 1 & save.rank) {
# save(weights, file = paste("ranking.", nrow(weights), ".RData", sep = ""))
# }
# if(variable.number != 0) {
# new.fea <<- rownames(weights)[1:variable.number]
# message("- Remained Features:")
# cat(new.fea, fill = TRUE, labels = " ", sep = " ")
# message("- Omitted Features:")
# cat(rownames(weights)[-(1:variable.number)], fill = TRUE, labels = " ", sep = " ")
# message("- New Dataset Loaded. Variables: ", variable.number)
# message("- Remained Iterations: ", length(variable.group) - which(variable.group == variable.number))
# message("")
# }
# perf
# })
#
# ### Assign Column Names
# var.colnames <- variable.group[which(variable.group != 0)]
# var.colnames <- c(feature.num - 1, var.colnames)
# colnames(perf.all) <- var.colnames
#
# ### Assign Row Names
# folds.names <- sapply(c(1:10), function(x) paste("Fold", x, sep = ""))
# rfe.rownames <- c()
# for(folds.index in folds.names){
# for (metric in c("Sensitivity", "Specificity", "Accuracy", "F.Measure", "Kappa")) {
# temp.name <- paste(metric, folds.index, sep = ".")
# rfe.rownames <- c(rfe.rownames, temp.name)
# }
# }
# row.names(perf.all) <- rfe.rownames
#
# ### Obtain the Average Performance
# Ave <- apply(perf.all, 2, function(col){
# Ave.res <- data.frame(Sensitivity = mean(unlist(col[seq(1, 50, 5)])),
# Specificity = mean(unlist(col[seq(2, 50, 5)])),
# Accuracy = mean(unlist(col[seq(3, 50, 5)])),
# F.Measure = mean(unlist(col[seq(4, 50, 5)])),
# Kappa = mean(unlist(col[seq(5, 50, 5)])))
#
# })
# Ave.res <- sapply(Ave, rbind)
# Ave.res <- t(Ave.res)
# Ave.res <- as.data.frame(apply(Ave.res, 2, unlist))
# # Ave.res <- as.data.frame(Ave.res[nrow(Ave.res):1,])
#
# perf.all.final <- list(raw.perf = perf.all, ave.perf = Ave.res)
#
# message("")
# message("+ RFE Process Completed. ", Sys.time())
# perf.all.final
# }
get.Seq_UP <- function(OneSeq) {
UP.seq <- seqinr::s2c(OneSeq[[2]])
UP.seq[UP.seq %in% "(" | UP.seq %in% ")"] <- "P"
UP.seq[UP.seq %in% "."] <- "U"
UP.seq
}
get.Seq_acguACGU <- function(OneSeq) {
ACGU.seq <- seqinr::s2c(OneSeq[[1]])
Stem.index <- seqinr::s2c(OneSeq[[2]]) %in% "(" | seqinr::s2c(OneSeq[[2]]) %in% ")"
ACGU.seq[Stem.index & ACGU.seq %in% "a"] <- "A"
ACGU.seq[Stem.index & ACGU.seq %in% "c"] <- "C"
ACGU.seq[Stem.index & ACGU.seq %in% "g"] <- "G"
ACGU.seq[Stem.index & ACGU.seq %in% "u"] <- "U"
ACGU.seq
}
get.Seq_acguD <- function(OneSeq) {
acguD.seq <- seqinr::s2c(OneSeq[[1]])
Dot.index <- seqinr::s2c(OneSeq[[2]]) %in% "."
acguD.seq[Dot.index] <- "D"
acguD.seq
}
get.Seq_DNA <- function(OneSeq) {
DNA.seq <- seqinr::s2c(OneSeq[[1]])
DNA.seq[DNA.seq %in% "u"] <- "t"
DNA.seq
}
find_ORF <- function(OneSeq, max.only = TRUE) {
OneSeq <- unlist(seqinr::getSequence(OneSeq, as.string = TRUE))
OneSeq <- gsub("\n", "", OneSeq)
start_pos <- unlist(gregexpr("atg", OneSeq, ignore.case = TRUE))
if(sum(start_pos) == -1) {
if(max.only) {
ORF_info <- list(ORF.Max.Len = 0, ORF.Max.Cov = 0, ORF.Max.Seq = NA)
} else {
ORF_info <- data.frame(ORF.Seq = NA, ORF.Start = 0, ORF.Stop = 0, ORF.Len = 0)
}
} else {
stop_pos <- sapply(c("taa", "tag", "tga"), function(x){
pos <- unlist(gregexpr(x, OneSeq, ignore.case = TRUE))
})
stop_pos <- sort(unlist(stop_pos, use.names = FALSE))
seq_length <- nchar(OneSeq)
if(all(stop_pos == -1)) {
if(max.only) {
orf_start <- min(start_pos)
orf_stop <- seq_length - ((seq_length - orf_start + 1) %% 3) - 2
max_len <- orf_stop - orf_start + 3
max_cov <- max_len / seq_length
orf_seq <- substr(OneSeq, start = orf_start, stop = orf_stop + 2)
ORF_info <- list(ORF.Max.Len = max_len, ORF.Max.Cov = max_cov, ORF.Max.Seq = orf_seq)
} else {
for(i in seq_along(start_pos)) {
start.val <- start_pos[i]
stop.val <- seq_length - ((seq_length - start.val + 1) %% 3) - 2
length.val <- stop.val - start.val + 3
cover.val <- length.val / seq_length
ORF.seq <- substr(OneSeq, start = start.val, stop = stop.val + 2)
output.tmp <- data.frame(ORF.Seq = ORF.seq, ORF.Start = start.val, ORF.Stop = stop.val,
ORF.Len = length.val, ORF.Cov = cover.val, stringsAsFactors = FALSE)
if(i == 1) {
ORF_info <- output.tmp
} else {
ORF_info <- rbind(ORF_info, output.tmp)
}
}
}
} else {
orf_starts <- c()
orf_stops <- c()
orf_lengths <- c()
for(i in start_pos){
orf_flag <- 0
for(j in stop_pos){
if(j < i) next
diff_mod <- (j - i) %% 3
if(diff_mod != 0) next
orf_starts <- c(orf_starts, i)
orf_stops <- c(orf_stops, j)
orf_lengths <- c(orf_lengths, j - i + 3)
orf_flag <- 1
break
}
if(orf_flag == 0){
orf_starts <- c(orf_starts, i)
orf_stop_tmp <- seq_length - ((seq_length - i + 1) %% 3) - 2
orf_stops <- c(orf_stops, orf_stop_tmp)
orf_lengths <- c(orf_lengths, orf_stop_tmp - i + 3)
}
}
if(max.only) {
max_len <- max(orf_lengths)
max_cov <- max_len / seq_length
max_index <- which(orf_lengths == max_len)
orf_start <- orf_starts[max_index]
orf_stop <- orf_stops[max_index]
orf_seq <- substr(OneSeq, start = orf_start, stop = orf_stop + 2)
ORF_info <- list(ORF.Max.Len = max_len, ORF.Max.Cov = max_cov, ORF.Max.Seq = orf_seq)
} else {
for(i in seq_along(orf_starts)) {
start.val <- orf_starts[i]
stop.val <- orf_stops[i] + 2
length.val <- orf_lengths[i]
cover.val <- length.val / seq_length
ORF.seq <- substr(OneSeq, start = start.val, stop = stop.val)
output.tmp <- data.frame(ORF.Seq = ORF.seq, ORF.Start = start.val, ORF.Stop = stop.val,
ORF.Len = length.val, ORF.Cov = cover.val, stringsAsFactors = FALSE)
if(i == 1) {
ORF_info <- output.tmp
} else {
ORF_info <- rbind(ORF_info, output.tmp)
}
}
}
}
}
ORF_info
}
get.freq <- function(seqs, alphabet, wordsize, step, freq, ignore.illegal = TRUE) {
if(ignore.illegal) {
for(i in 1:length(seqs)) {
if(!all(seqs[[i]] == "a" | seqs[[i]] == "c" | seqs[[i]] == "g" | seqs[[i]] == "t")) next
freq_tmp <- seqinr::count(seqs[[i]], wordsize = wordsize,
by = step, freq = freq, alphabet = alphabet)
if(i == 1) freq.res <- freq_tmp else freq.res <- freq.res + freq_tmp
if(i %% 5000 == 0) message(" ", i, " sequences completed.")
}
} else {
for(i in 1:length(seqs)) {
freq_tmp <- seqinr::count(seqs[[i]], wordsize = wordsize,
by = step, freq = freq, alphabet = alphabet)
if(i == 1) freq.res <- freq_tmp else freq.res <- freq.res + freq_tmp
if(i %% 5000 == 0) message(" ", i, " sequences completed.")
}
}
freq.out <- freq.res / sum(freq.res)
freq.out
}
LogDist.DNA <- function(OneSeq, hexamer.lnc, hexamer.cds, wordsize, step) {
orf.info <- find_ORF(OneSeq)
count6 <- seqinr::count(seqinr::s2c(orf.info[[3]]), wordsize = wordsize,
by = step, freq = FALSE)
if(sum(count6) < 3) {
count6 <- seqinr::count(OneSeq, wordsize = wordsize,
by = step, freq = FALSE)
}
freq6 <- count6 / sum(count6)
lnc.ratio <- freq6[hexamer.lnc != 0] / hexamer.lnc[hexamer.lnc != 0]
pct.ratio <- freq6[hexamer.cds != 0] / hexamer.cds[hexamer.cds != 0]
lnc.dist <- (sum(log(lnc.ratio[lnc.ratio != 0])) - length(which(lnc.ratio == 0)) + length(which(hexamer.lnc == 0))) / sum(count6)
pct.dist <- (sum(log(pct.ratio[pct.ratio != 0])) - length(which(pct.ratio == 0)) + length(which(hexamer.cds == 0))) / sum(count6)
Ratio <- lnc.dist / pct.dist
distance <- c(ORF.Max.Len = orf.info[[1]], ORF.Max.Cov = orf.info[[2]],
Seq.lnc.Dist = lnc.dist, Seq.pct.Dist = pct.dist, Seq.Dist.Ratio = Ratio)
}
LogDist.acguD <- function(OneSeq, hexamer.lnc, hexamer.cds, wordsize, step) {
count6 <- seqinr::count(OneSeq, wordsize = wordsize, freq = FALSE, by = step,
alphabet = c("D", "a", "c", "g", "u"))
freq6 <- count6 / sum(count6)
lnc.ratio <- freq6[hexamer.lnc != 0] / hexamer.lnc[hexamer.lnc != 0]
pct.ratio <- freq6[hexamer.cds != 0] / hexamer.cds[hexamer.cds != 0]
lnc.dist <- (sum(log(lnc.ratio[lnc.ratio != 0])) - length(which(lnc.ratio == 0)) + length(which(hexamer.lnc == 0))) / sum(count6)
pct.dist <- (sum(log(pct.ratio[pct.ratio != 0])) - length(which(pct.ratio == 0)) + length(which(hexamer.cds == 0))) / sum(count6)
Ratio <- lnc.dist / pct.dist
distance <- c(Dot_lnc.dist = lnc.dist, Dot_pct.dist = pct.dist, Dot_Dist.Ratio = Ratio)
}
LogDist.acguACGU <- function(OneSeq, hexamer.lnc, hexamer.cds, wordsize, step) {
count6 <- seqinr::count(OneSeq, wordsize = wordsize, freq = FALSE, by = step,
alphabet = c("A", "C", "G", "U", "a", "c", "g", "u"))
freq6 <- count6 / sum(count6)
lnc.ratio <- freq6[hexamer.lnc != 0] / hexamer.lnc[hexamer.lnc != 0]
pct.ratio <- freq6[hexamer.cds != 0] / hexamer.cds[hexamer.cds != 0]
lnc.dist <- (sum(log(lnc.ratio[lnc.ratio != 0])) - length(which(lnc.ratio == 0)) + length(which(hexamer.lnc == 0))) / sum(count6)
pct.dist <- (sum(log(pct.ratio[pct.ratio != 0])) - length(which(pct.ratio == 0)) + length(which(hexamer.cds == 0))) / sum(count6)
Ratio <- lnc.dist / pct.dist
distance <- c(SS.lnc.dist = lnc.dist, SS.pct.dist = pct.dist, SS.Dist.Ratio = Ratio)
}
secondary_seq <- function(OneSeq, info, RNAfold.path){
seq.string <- unlist(seqinr::getSequence(OneSeq, TRUE))
# assign("index", index + 1, inherits = TRUE)
index <- get("index")
showMessage <- paste(index, "of", info, "length:", nchar(seq.string), "nt", "\n")
cat(showMessage)
RNAfold.command <- paste(RNAfold.path, "--noPS")
seq.ss <- system(RNAfold.command, intern = TRUE, input = seq.string)
index <<- index + 1
seq.ss[3] <- as.numeric(substr(seq.ss[2], nchar(seq.string) + 3, nchar(seq.ss[2]) - 1))
seq.ss[2] <- substr(seq.ss[2], 1, nchar(seq.string))
seq.ss
}
# CPAT.evaluate <- function(path) {
#
# dataset <- read.table(file = path, sep ="\t", header = T)
#
# set.seed(1)
# folds <- caret::createFolds(dataset$label, k = 10, returnTrain = TRUE)
#
# threshold <- sapply(folds, function(x) {
# subset <- dataset[x, ]
# test.set <- dataset[-x, ]
# glm.mod <- glm(label ~ mRNA + ORF + Fickett + Hexamer, data = subset, family = binomial(link="logit"))
# res <- predict(glm.mod, test.set, type = "response")
# res <- data.frame(Prob = res, label = test.set$label)
# threshold <- pROC::coords(pROC::roc(res$label, res$Prob), x = "best", ret='threshold')[[1]]
# })
# best.cutoff <- round(sum(threshold) / 10, digits = 4)
#
# performance <- sapply(folds, function(x) {
# subset <- dataset[x, ]
# test.set <- dataset[-x, ]
# glm.mod <- glm(label ~ mRNA + ORF + Fickett + Hexamer, data = subset, family = binomial(link="logit"))
# res <- predict(glm.mod, test.set, type = "response")
# res <- data.frame(Prob = res, label = test.set$label)
#
# res$Pred <- ifelse(res$Prob >= best.cutoff, "Coding", "NonCoding")
# res$label <- ifelse(res$label == 1, "Coding", "NonCoding")
# confusion.res <- caret::confusionMatrix(res$Pred, res$label, mode = "everything", positive = "NonCoding")
# performance.res <- data.frame(Sensitivity = confusion.res$byClass[1],
# Specificity = confusion.res$byClass[2],
# Accuracy = confusion.res$overall[1],
# F.Measure = confusion.res$byClass[7],
# Kappa = confusion.res$overall[2])
# })
#
# Ave.res <- apply(performance, 1, as.numeric)
# Ave.res <- as.data.frame(t(Ave.res))
# Ave.res <- rowMeans(Ave.res)
# output <- list(Best.Cutoff = best.cutoff, Performance = Ave.res)
# }
###### Reference frequencies ######
#' Make Frequencies File for Log.Dist, Euc.Dist, and hexamer score
#'
#' @description This function is used to calculate the frequencies of lncRNAs and CDs.
#' The Frequencies file can be used to calculate Logarithm-Distance (\code{\link{compute_LogDistance}}),
#' Euclidean-Distance (\code{\link{compute_EucDistance}}), and hexamer score (\code{\link{compute_hexamerScore}}).
#'
#' NOTE: If users need to make frequencies file to build
#' new LncFinder classifier using function \code{\link{extract_features}},
#' please refer to function \code{make_frequencies}.
#'
#' @param cds.seq Coding sequences (mRNA without UTRs). Can be a FASTA file loaded
#' by \code{\link[seqinr]{seqinr-package}}.
#'
#' @param lncRNA.seq Long non-coding RNA sequences. Can be a FASTA file loaded by
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param k An integer that indicates the sliding window size. (Default: \code{6})
#'
#' @param step Integer defaulting to \code{1} for the window step.
#'
#' @param alphabet A vector of single characters that specify the different character
#' of the sequence. (Default: \code{alphabet = c("a", "c", "g", "t")})
#'
#' @param on.orf Logical. Incomplete CDs can lead to a false shift and a
#' inaccurate hexamer frequencies. When \code{on.orf = TRUE}, the frequencies
#' will be calculated on the longest ORF. This parameter is strongly recommended to
#' set as \code{TRUE} when mRNA is used as CDs. Only available when
#' \code{alphabet = c("a", "c", "g", "t")}. (Default: \code{TRUE})
#'
#' @param ignore.illegal Logical. If \code{TRUE}, the sequences with non-nucleotide
#' characters (nucleotide characters: "a", "c", "g", "t") will be ignored when
#' calculating the frequencies. Only available when \code{alphabet = c("a", "c", "g", "t")}.
#' (Default: \code{TRUE})
#'
#' @return Returns a list which consists the frequencies of protein-coding sequences
#' and non-coding sequences.
#'
#' @author HAN Siyu
#' @details This function is used to make frequencies file for the computation of
#' Logarithm-Distance (\code{\link{compute_LogDistance}}), Euclidean-Distance
#' (\code{\link{compute_EucDistance}}),
#' and hexamer score (\code{\link{compute_hexamerScore}}).
#'
#' In order to achieve high accuracy, mRNA should not be regarded as CDs and assigned
#' to parameter \code{cds.seq}. However, CDs of some species may be insufficient
#' for calculating frequencies. In that case, mRNAs can be regarded as CDs with parameter
#' \code{on.orf = TRUE}, and the frequencies will be calculated on ORF region.
#' If \code{on.orf = TRUE}, users can set \code{step = 3} to simulate the translation process.
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#'
#' @seealso \code{\link{make_frequencies}},
#' \code{\link{compute_LogDistance}},
#' \code{\link{compute_EucDistance}},
#' \code{\link{compute_hexamerScore}}.
#'
#' @examples
#' \dontrun{
#' Seqs <- seqinr::read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#'
#' referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1,
#' alphabet = c("a", "c", "g", "t"), on.orf = TRUE,
#' ignore.illegal = TRUE)
#' }
#'
#' @export
make_referFreq <- function(cds.seq, lncRNA.seq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"),
on.orf = TRUE, ignore.illegal = TRUE) {
if(on.orf & !all(alphabet %in% c("a", "t", "g", "c"))) {
stop("Error: The cds.seq has to be DNA sequences!")
}
if(!all(alphabet %in% c("a", "t", "g", "c"))) {
ignore.illegal = FALSE
}
message("+ Calculating frequencies. ", Sys.time(), "\n")
if(on.orf) {
message("- Finding ORFs")
orf.seq <- lapply(cds.seq, function(x) {
orf.info <- find_ORF(x)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
cds.seq <- orf.seq[!is.na(orf.seq)]
}
message("- Calculating frequencies.")
message("\n", " Non-coding sequences")
lnc.freq <- get.freq(lncRNA.seq, alphabet = alphabet, wordsize = k,
step = step, freq = F, ignore.illegal = ignore.illegal)
message(" Completed.", "\n")
message(" Coding sequences")
cds.freq <- get.freq(cds.seq, alphabet = alphabet, wordsize = k,
step = step, freq = F, ignore.illegal = ignore.illegal)
message(" Completed.", "\n")
message("+ Frequencies calculation completed. ", Sys.time())
Internal.freq <- list(ref.lnc = lnc.freq, ref.cds = cds.freq)
Internal.freq
}
###### Logarithm-Distance ######
#' Compute Logarithm Distance
#'
#' @description This function can compute Logarithm Distance proposed by method LncFinder
#' (Han et al. 2018). Logarithm Distance can be calculated on full sequence or the longest ORF
#' region. The step and \emph{k} of the sliding window can also be customized.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param referFreq a list obtained from function \code{\link{make_referFreq}}.
#'
#' @param k An integer that indicates the sliding window size. (Default: \code{6})
#'
#' @param step Integer defaulting to \code{1} for the window step.
#'
#' @param alphabet A vector of single characters that specify the different character
#' of the sequence. (Default: \code{alphabet = c("a", "c", "g", "t")})
#'
#' @param on.ORF Logical. If \code{TRUE}, Logarithm Distance will be calculated on
#' the longest ORF region. NOTE: If \code{TRUE}, the input has to be DNA sequences.
#' (Default: \code{FALSE})
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, Logarithm Distance will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded. Ignored when \code{on.ORF = FALSE}.
#' (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details This function can compute Logarithm Distance proposed by LncFinder (HAN et al. 2018).
#' In LncFinder, two schemes are provided to calculate Logarithm Distance:
#' 1) \code{step = 3} and \code{k = 6} on the longest ORF region;
#' 2) \code{step = 1} and \code{k = 6} on full sequence.
#' Method LncFinder uses scheme 1 to extract Logarithm Distance features.
#' Using this function \code{compute_EucDistance}, both \code{step}, \code{k},
#' and calculated region (full sequence or ORF)
#' can be customized to maximize its availability.
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @seealso \code{\link{make_referFreq}},
#' \code{\link{compute_EucDistance}},
#' \code{\link{compute_hexamerScore}}.
#'
#' @examples
#' \dontrun{
#' Seqs <- seqinr::read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#'
#' referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3,
#' alphabet = c("a", "c", "g", "t"), on.orf = TRUE,
#' ignore.illegal = TRUE)
#'
#' data(demo_DNA.seq)
#' Sequences <- demo_DNA.seq
#'
#' LogDistance <- compute_LogDistance(Sequences, label = "NonCoding", referFreq = referFreq,
#' k = 6, step = 3, alphabet = c("a", "c", "g", "t"),
#' on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2)
#' }
#'
#' @export
compute_LogDistance <- function(Sequences, label = NULL, referFreq,
k = 6, step = 1, alphabet = c("a", "c", "g", "t"),
on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2) {
if(on.ORF & !all(alphabet %in% c("a", "t", "g", "c"))) {
stop("Error: Calculation of Logarithm Distance on ORF region can only be applied to DNA sequences!")
}
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = "find_ORF", envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
message("Calculating Logarithm Distance...")
seqFreq <- parallel::parSapply(cl, Sequences, Internal.LogDistance, k = k, step = step,
alphabet = alphabet, referFreq = referFreq)
parallel::stopCluster(cl)
seqFreq.df <- data.frame(t(seqFreq))
if(!is.null(label)) seqFreq.df <- cbind(label = label, seqFreq.df)
message("\n", "Completed. ", Sys.time(), "\n")
seqFreq.df
}
###### Euclidean-Distance ######
#' Compute Euclidean Distance
#'
#' @description This function can compute Euclidean Distance proposed by method LncFinder
#' (Han et al. 2018). Euclidean Distance can be calculated on full sequence or the longest ORF
#' region. The step and \emph{k} of the sliding window can also be customized.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param referFreq a list obtained from function \code{\link{make_referFreq}}.
#'
#' @param k An integer that indicates the sliding window size. (Default: \code{6})
#'
#' @param step Integer defaulting to \code{1} for the window step.
#'
#' @param alphabet A vector of single characters that specify the different character
#' of the sequence. (Default: \code{alphabet = c("a", "c", "g", "t")})
#'
#' @param on.ORF Logical. If \code{TRUE}, Euclidean Distance will be calculated on
#' the longest ORF region. NOTE: If \code{TRUE}, the input has to be DNA sequences.
#' (Default: \code{FALSE})
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, Euclidean Distance will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded. Ignored when \code{on.ORF = FALSE}.
#' (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details This function can compute Euclidean Distance proposed by LncFinder (HAN et al. 2018).
#' In LncFinder, two schemes are provided to calculate Euclidean Distance:
#' 1) \code{step = 3} and \code{k = 6} on the longest ORF region;
#' 2) \code{step = 1} and \code{k = 6} on full sequence.
#' Using this function \code{compute_EucDistance}, both \code{step}, \code{k},
#' and calculated region (full sequence or ORF)
#' can be customized to maximize its availability.
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @seealso \code{\link{make_referFreq}},
#' \code{\link{compute_LogDistance}},
#' \code{\link{compute_hexamerScore}}.
#'
#' @examples
#' \dontrun{
#' Seqs <- seqinr::read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#'
#' referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3,
#' alphabet = c("a", "c", "g", "t"), on.orf = TRUE,
#' ignore.illegal = TRUE)
#'
#' data(demo_DNA.seq)
#' Sequences <- demo_DNA.seq
#'
#' EucDistance <- compute_EucDistance(Sequences, label = "NonCoding", referFreq = referFreq,
#' k = 6, step = 3, alphabet = c("a", "c", "g", "t"),
#' on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2)
#' }
#'
#' @export
compute_EucDistance <- function(Sequences, label = NULL, referFreq,
k = 6, step = 1, alphabet = c("a", "c", "g", "t"),
on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2) {
if(on.ORF & !all(alphabet %in% c("a", "t", "g", "c"))) {
stop("Error: Calculation of Euclidean Distance on ORF region can only be applied to DNA sequences!")
}
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = "find_ORF", envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
message("Calculating Euclidean Distance...")
seqFreq <- parallel::parSapply(cl, Sequences, Internal.EucDistance, k = k, step = step,
alphabet = alphabet, referFreq = referFreq)
parallel::stopCluster(cl)
seqFreq.df <- data.frame(t(seqFreq))
if(!is.null(label)) seqFreq.df <- cbind(label = label, seqFreq.df)
message("\n", "Completed. ", Sys.time(), "\n")
seqFreq.df
}
###### Hexamer Score ######
#' Compute Hexamer Score
#'
#' @description This function can compute hexamer score proposed by method CPAT
#' (Wang et al. 2013). Hexamer score can be calculated on full sequence or the longest ORF
#' region. The step and \emph{k} of the sliding window can also be customized.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param referFreq A list obtained from function \code{\link{make_referFreq}}.
#'
#' @param k An integer that indicates the sliding window size. (Default: \code{6})
#'
#' @param step Integer defaulting to \code{1} for the window step.
#'
#' @param alphabet A vector of single characters that specify the different character
#' of the sequence. (Default: \code{alphabet = c("a", "c", "g", "t")})
#'
#' @param on.ORF Logical. If \code{TRUE}, hexamer score will be calculated on
#' the longest ORF region. NOTE: If \code{TRUE}, the input has to be DNA sequences.
#' (Default: \code{FALSE})
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, hexamer score will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded. Ignored when \code{on.ORF = FALSE}.
#' (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details This function can compute hexamer score proposed by CPAT (Wang et al. 2013).
#' In CPAT, hexamer score is calculated on the longest ORF region, and the step of the
#' sliding window is 3 (i.e. \code{step = 3}). Hexamer means six adjoining bases, thus
#' \code{k = 6}. But in function \code{compute_hexamerScore}, both \code{step}, \code{k},
#' and calculated region (full sequence or ORF)
#' can be customized to maximize its availability.
#'
#' @section References:
#' Liguo Wang, Hyun Jung Park, Surendra Dasari, Shengqin Wang, JeanPierre Kocher, & Wei Li.
#' CPAT: coding-potential assessment tool using an alignment-free logistic regression model.
#' \emph{Nucleic Acids Research}, 2013, 41(6):e74-e74.
#'
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @seealso \code{\link{make_referFreq}},
#' \code{\link{compute_LogDistance}},
#' \code{\link{compute_EucDistance}}.
#'
#' @examples
#' \dontrun{
#' Seqs <- seqinr::read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#'
#' referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1,
#' alphabet = c("a", "c", "g", "t"), on.orf = TRUE,
#' ignore.illegal = TRUE)
#'
#' data(demo_DNA.seq)
#' Sequences <- demo_DNA.seq
#'
#' hexamerScore <- compute_hexamerScore(Sequences, label = "NonCoding", referFreq = referFreq,
#' k = 6, step = 1, alphabet = c("a", "c", "g", "t"),
#' on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2)
#' }
#'
#' @export
compute_hexamerScore <- function(Sequences, label = NULL, referFreq,
k = 6, step = 1, alphabet = c("a", "c", "g", "t"),
on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2) {
if(on.ORF & !all(alphabet %in% c("a", "t", "g", "c"))) {
stop("Error: Calculation of hexamer score on ORF region can only be applied to DNA sequences!")
}
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = "find_ORF", envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
message("Calculating hexamer score...")
seqFreq <- parallel::parSapply(cl, Sequences, Internal.hexamerScore, k = k, step = step,
alphabet = alphabet, referFreq = referFreq)
parallel::stopCluster(cl)
seqFreq.df <- data.frame(Hexamer.Score = seqFreq)
if(!is.null(label)) seqFreq.df <- cbind(label = label, seqFreq.df)
message("\n", "Completed. ", Sys.time(), "\n")
seqFreq.df
}
###### k-mer scheme ######
#' Compute \emph{k}-mer Features
#'
#' @description This function can calculate the \emph{k}-mer frequencies of the sequences.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param k An integer that indicates the sliding window size. (Default: \code{1:5})
#'
#' @param step Integer defaulting to \code{1} for the window step.
#'
#' @param freq Logical. If TRUE, the frequencies of different patterns are returned
#' instead of counts. (Default: \code{TRUE})
#'
#' @param improved.mode Logical. If TRUE, the frequencies will be normalized using
#' the method proposed by PLEK (Li et al. 2014).
#' Ignored if \code{freq = FALSE}. (Default: \code{FALSE})
#'
#' @param alphabet A vector of single characters that specify the different character
#' of the sequence. (Default: \code{alphabet = c("a", "c", "g", "t")})
#'
#' @param on.ORF Logical. If \code{TRUE}, the \emph{k}-mer frequencies will be calculated on
#' the longest ORF region. NOTE: If \code{TRUE}, the sequences have to be DNA.
#' (Default: \code{FALSE})
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, the \emph{k}-mer
#' frequencies will be calculated on the full sequence automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded.
#' Ignored when \code{on.ORF = FALSE}. (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details
#' This function can extract \emph{k}-mer features. \code{k} and \code{step} can be customized.
#' The count (\code{freq = FALSE}) or frequencies (\code{freq = TRUE}) of different patterns can be returned.
#' If \code{freq = TRUE}, \code{improved.mode} is available. The improved mode is proposed by method PLEK.
#' (Ref: Li et al. 2014)
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' kmer_res1 <- compute_kmer(Seqs, k = 1:5, step = 1, freq = TRUE, improved.mode = FALSE)
#'
#' kmer_res2 <- compute_kmer(Seqs, k = 1:5, step = 3, freq = TRUE,
#' improved.mode = TRUE, on.ORF = TRUE, auto.full = TRUE)
#' }
#'
#' @export
compute_kmer <- function(Sequences, label = NULL, k = 1:5, step = 1, freq = TRUE,
improved.mode = FALSE, alphabet = c("a", "c", "g", "t"),
on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2) {
if(on.ORF & !all(alphabet %in% c("a", "t", "g", "c"))) {
stop("Error: Calculation of k-mer frequencies on ORF region can only be applied to DNA sequences!")
}
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = "find_ORF", envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
for (i in k) {
message("Calculating ", i, "-mer frequencies...")
i.freq <- parallel::parSapply(cl, Sequences, seqinr::count, wordsize = i,
by = step, freq = freq, alphabet = alphabet)
if(improved.mode & freq) {
weight <- 1 / (length(alphabet) ^ (max(k) - i))
i.freq <- i.freq * weight
}
i.freq <- data.frame(t(i.freq))
if(i == k[1]) {
k.freq <- i.freq
} else {
k.freq <- cbind(k.freq, i.freq)
}
}
parallel::stopCluster(cl)
if(!is.null(label)) k.freq <- cbind(label = label, k.freq)
message("\n", "Completed. ", Sys.time(), "\n")
k.freq
}
###### Fickett Score ######
#' Compute Fickett TESTCODE Score
#'
#' @description This function can compute Fickett TESTCODE score of DNA sequences proposed by James W.Fickett
#' (Fickett JW. 1982). Fickett TESTCODE score can be calculated on full sequence or the longest ORF
#' region.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param on.ORF Logical. If \code{TRUE}, Fickett TESTCODE score will be calculated on
#' the longest ORF region.
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, Fickett TESTCODE score will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded.
#' Ignored when \code{on.ORF = FALSE}. (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details This function can compute Fickett TESTCODE score proposed by James W.Fickett (Fickett JW. 1982).
#' Fickett TESTCODE score is selected as feature by method CPAT (Wang et al. 2013) and CPC2 (Kang et al. 2017).
#' In CPAT, Fickett TESTCODE score is calculated on the longest ORF region, but CPC2 calculates the score
#' on full sequence. This function \code{compute_FickettScore} improves the CPAT's code
#' and is capable of computing the score on the longest ORF region as well as full sequence.
#'
#' @section References:
#' James W.Fickett.
#' Recognition of protein coding regions in DNA sequences.
#' \emph{Nucleic Acids Research}, 1982, 10(17):5303-5318.
#'
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' Liguo Wang, Hyun Jung Park, Surendra Dasari, Shengqin Wang, JeanPierre Kocher & Wei Li.
#' CPAT: coding-potential assessment tool using an alignment-free logistic regression model.
#' \emph{Nucleic Acids Research}, 2013, 41(6):e74-e74.
#'
#' Yu-Jian Kang, De-Chang Yang, Lei Kong, Mei Hou, Yu-Qi Meng, Liping Wei & Ge Gao.
#' CPC2: a fast and accurate coding potential calculator based on sequence intrinsic features.
#' \emph{Nucleic Acids Research}, 2017, 45(W1):W12-W16.
#'
#' @importFrom seqinr count
#' @importFrom seqinr s2c
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' FickettScore <- compute_FickettScore(Seqs, label = NULL, on.ORF = TRUE,
#' auto.full = TRUE, parallel.cores = 2)
#' }
#' @export
compute_FickettScore <- function(Sequences, label = NULL, on.ORF = FALSE,
auto.full = FALSE, parallel.cores = 2) {
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = c("find_ORF", "Internal.convertProb"), envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
positionProb = list(a = c(0.94,0.68,0.84,0.93,0.58,0.68,0.45,0.34,0.20,0.22),
c = c(0.80,0.70,0.70,0.81,0.66,0.48,0.51,0.33,0.30,0.23),
g = c(0.90,0.88,0.74,0.64,0.53,0.48,0.27,0.16,0.08,0.08),
t = c(0.97,0.97,0.91,0.68,0.69,0.44,0.54,0.20,0.09,0.09))
positionWeight = c(a = 0.26, c = 0.18, g = 0.31, t = 0.33)
positionParam = c(1.9, 1.8, 1.7, 1.6, 1.5 ,1.4, 1.3, 1.2, 1.1, 0)
contentProb = list(a = c(0.28,0.49,0.44,0.55,0.62,0.49,0.67,0.65,0.81,0.21),
c = c(0.82,0.64,0.51,0.64,0.59,0.59,0.43,0.44,0.39,0.31),
g = c(0.40,0.54,0.47,0.64,0.64,0.73,0.41,0.41,0.33,0.29),
t = c(0.28,0.24,0.39,0.40,0.55,0.75,0.56,0.69,0.51,0.58))
contentWeight = c(a = 0.11, c = 0.12, g = 0.15, t = 0.14)
contentParam = c(0.33, 0.31, 0.29, 0.27, 0.25, 0.23, 0.21, 0.19, 0.17, 0)
message("Calculating Fickett TESTCODE score...")
FickettScore.res <- parallel::parSapply(cl, Sequences, Internal.FickettScore,
.positionProb = positionProb, .positionWeight = positionWeight,
.positionParam = positionParam, .contentProb = contentProb,
.contentWeight = contentWeight, .contentParam = contentParam)
parallel::stopCluster(cl)
FickettScore.df <- data.frame(Fickett.Score = FickettScore.res)
if(!is.null(label)) FickettScore.df <- cbind(label = label, FickettScore.df)
message("\n", "Completed. ", Sys.time(), "\n")
FickettScore.df
}
###### GC Content ######
#' Calculate GC content
#' @description This function can GC content of the input sequences.
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param on.ORF Logical. If \code{TRUE}, GC content will be calculated on
#' the longest ORF region.
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, GC content will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded.
#' Ignored when \code{on.ORF = FALSE}. (Default: \code{FALSE})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#'
#' @author HAN Siyu
#'
#' @details This function can basically compute GC content of DNA sequences:
#' GC content = (nc + ng) / (na + nc + ng + nt).
#' The function will ignored the ambiguous bases.
#'
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @seealso \code{\link[seqinr]{GC}} (package "\code{\link[seqinr]{seqinr-package}}")
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' gcContent <- compute_GC(Seqs, label = "NonCoding",on.ORF = TRUE,
#' auto.full = TRUE, parallel.cores = 2)
#' }
#' @export
#'
compute_GC <- function(Sequences, label = NULL, on.ORF = FALSE,
auto.full = FALSE, parallel.cores = 2) {
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = c("find_ORF"), envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
message("Calculating GC content...")
GC.content <- parallel::parSapply(cl, Sequences, function(x) {
num.a <- sum(x == "a")
num.c <- sum(x == "c")
num.g <- sum(x == "g")
num.t <- sum(x == "t")
gc.content <- (num.g + num.c) / (num.a + num.c + num.g + num.t)
})
parallel::stopCluster(cl)
GC.content <- as.data.frame(GC.content, stringsAsFactors = FALSE)
if(!is.null(label)) GC.content <- cbind(label = label, GC.content)
message("\n", "Completed. ", Sys.time(), "\n")
GC.content
}
###### EIIP Features ######
#' Extract the EIIP-derived features
#'
#' @description This function can extract EIIP-derived features proposed by Han et al (2018).
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#' @param spectrum.percent Numeric specifying the percentage of the sorted power spectrum that be
#' used to calculate the quantile-based features. For example, if \code{spectrum.percent = 0.1},
#' the top 10\% percent of the sorted power spectrum will be used to compute the quantiles.
#' @param quantile.probs Numeric. The probabilities with values in [0,1].
#'
#' @return A dataframe including the EIIP-derived features.
#'
#' @author HAN Siyu
#'
#' @details The function \code{compute_EIIP} can extract EIIP (electron-ion interaction pseudo-potential) features including:
#' signal at 1/3 position (\code{Signal.Peak}), average power (\code{Average.Power}), signal to noise ratio (\code{SNR}),
#' and quantile-based features of one specified percentage of the sorted power spectrum
#' (e.g. \code{0\%}, \code{20\%}, \code{40\%}, \code{60\%}, \code{70\%},
#' \code{100\%} when \code{quantile.probs = seq(0, 1, 0.2)} and \code{spectrum.percent =} \code{0.1}).
#'
#' In method LncFinder, EIIP features includes \code{Signal.Peak}, \code{SNR}, 0\% (\code{Signal.Min}),
#' 25\% (\code{Singal.Q1}, 50\% \code{Signal.Q2}), and 75\% (\code{Signal.Max}) of the top 10\% sorted
#' power spectrum, i.e. \code{quantile.prob} \code{= seq(0, 1, 0.25)} and \code{spectrum.percent = 0.1}.
#'
#' @importFrom stats fft
#' @importFrom stats quantile
#'
#' @seealso \code{\link{extract_features}}
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' \strong{Please cite the following paper, which originally proposed EIIP:}
#'
#' Lalović, Dragutin, and Veljko Veljković.
#' The global average DNA base composition of coding regions may be determined by the electron-ion interaction potential.
#' \emph{Biosystems}, 1990, 23(4):311-316.
#'
#' @examples
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' EIIP_res <- compute_EIIP(Seqs, label = "NonCoding", spectrum.percent = 0.25,
#' quantile.probs = seq(0, 1, 0.25))
#'
#' @export
compute_EIIP <- function(Sequences, label = NULL, spectrum.percent = 0.1,
quantile.probs = seq(0, 1, 0.25)) {
seqs.EIIP <- sapply(Sequences, get_EIIP, percent.length = spectrum.percent, probs = quantile.probs)
seqs.EIIP <- as.data.frame(t(seqs.EIIP), stringsAsFactors = FALSE)
if(!is.null(label)) seqs.EIIP <- cbind(label = label, seqs.EIIP)
seqs.EIIP
}
###### pI Features ######
#' Compute Theoretical Isoelectric Point
#'
#' @description This function is basically a wrapper for function \code{\link[seqinr]{computePI}}.
#' This function translate DNA sequence into protein, and compute the theoretical isoelectric point
#' (pI) of this protein.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param on.ORF Logical. If \code{TRUE}, pI will be calculated on
#' the longest ORF region. NOTE: If \code{TRUE}, the input has to be DNA sequences.
#' (Default: \code{FALSE})
#'
#' @param auto.full Logical. When \code{on.ORF = TRUE} but no ORF can be found,
#' if \code{auto.full = TRUE}, pI will be calculated on full sequences automatically;
#' if \code{auto.full} is \code{FALSE}, the sequences that have no ORF will be discarded.
#' Ignored when \code{on.ORF = FALSE}. (Default: \code{FALSE})
#'
#' @param ambiguous.base If \code{TRUE}, ambiguous bases are taken into account when
#' translating DNA sequences into proteins.
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return A dataframe.
#' @author HAN Siyu
#' @details This function can compute the pI of DNA sequences. Method CPC2 (Kang et al. 2017) uses this
#' feature to identify lncRNAs, and this feature is evaluated in the article LncFinder (Han et al. 2018).
#'
#' Using this function, the theoretical pI can be computed on full sequence or the longest ORF region.
#' In CPC2, pI is calculated on ORF region.
#'
#' @importFrom seqinr translate
#' @importFrom seqinr computePI
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel parLapply
#' @importFrom parallel stopCluster
#'
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Sequences <- demo_DNA.seq
#'
#' pI_res <- compute_pI(Sequences, on.ORF = TRUE, auto.full = FALSE, ambiguous.base = FALSE)
#' }
#' @export
compute_pI <- function(Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE,
ambiguous.base = FALSE, parallel.cores = 2) {
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
message("Processing... ", Sys.time(), "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = "find_ORF", envir = environment())
if(on.ORF & !auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
Sequences <- Sequences[!is.na(Sequences)]
}
if(on.ORF & auto.full) {
message("Calculating ORF region...")
Sequences <- parallel::parLapply(cl, Sequences, function(x) {
orf.info <- find_ORF(x, max.only = TRUE)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- x
orf
})
}
message("Calculating theoretical isoelectric point...")
AA.seq <- parallel::parLapply(cl, Sequences, seqinr::translate, ambiguous = ambiguous.base)
pI.val <- parallel::parSapply(cl, AA.seq, seqinr::computePI)
parallel::stopCluster(cl)
pI <- data.frame(pI = pI.val, stringsAsFactors = FALSE)
if(!is.null(label)) pI <- cbind(label = label, pI)
message("\n", "Completed. ", Sys.time(), "\n")
pI
}
###### SVM k-fold CV ######
#' \emph{k}-fold Cross Validation for SVM
#' @description This function conduct \emph{k}-fold Cross Validation for SVM.
#'
#' @param dataset The dataset obtained from function \code{\link{extract_features}}.
#' Or datasets used to build the classifier.
#'
#' @param label.col integer specifying the column number of the label. (Default: \code{1})
#'
#' @param positive.class Character. Indicate the positive class of the dataset.
#' (Default: \code{NonCoding}) The value of this parameter should be identical to
#' one of the classes of the response vectors.
#'
#' @param folds.num Integer. Specify the number of folds for cross-validation.
#' (Default: \code{10})
#'
#' @param seed Integer. Used to set the seed for cross-validation. (Default: \code{1})
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}, users can set as \code{-1} to run
#' this function with all cores. If the number of \code{parallel.cores} is more
#' than the \code{folds.num} (number of the folds for cross-validation), the
#' number of \code{parallel.cores} will be set as \code{folds.num} automatically.
#'
#' @param ... additional parameters for function \code{\link[e1071]{svm}}.
#'
#' @return Returns the optimal parameters when \code{return.model = FALSE}.
#' Or returns the best model when \code{return.model = TRUE}.
#'
#' @author HAN Siyu
#'
#' @details During the model tuning, the performance of each combination of
#' parameters will output. Sensitivity, Specificity, Accuracy, F-Measure and Kappa
#' Value are used to evaluate the performances. The best gamma and cost (or best
#' model) are selected based on Accuracy.
#'
#' For the details of parameter gamma and cost, please refer to function
#' \code{\link[e1071]{svm}} of package "e1071".
#'
#' For the details of metrics, please refer to function
#' \code{\link[caret]{confusionMatrix}} of package "caret".
#'
#' @importFrom caret createFolds
#' @importFrom caret confusionMatrix
#' @importFrom e1071 svm
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{extract_features}}, \code{\link{svm_tune}}.
#' @examples
#' \dontrun{
#' data(demo_dataset)
#' my_dataset <- demo_dataset
#'
#' cv_res <- svm_cv(my_dataset, folds.num = 4, seed = 1,
#' parallel.core = 2, cost = 3, kernel = "radial", gamma = 0.5)
#'
#' ### Users can set return.model = TRUE to return the best model.
#' }
#' @export
svm_cv <- function(dataset, label.col = 1, positive.class = NULL,
folds.num = 10, seed = 1, parallel.cores = 2, ...) {
names(dataset)[[label.col]] <- "label"
set.seed(seed)
folds <- caret::createFolds(dataset$label, k = folds.num, returnTrain = TRUE)
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
parallel.cores <- ifelse(parallel.cores > folds.num, folds.num, parallel.cores)
if(parallel.cores == 2 & folds.num > parallel.cores) {
message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
}
cl <- parallel::makeCluster(parallel.cores, outfile = "")
if(is.null(positive.class)) {
positive.class <- as.character(dataset$label[[1]])
parallel::clusterExport(cl, varlist = c("dataset", "positive.class"), envir = environment())
} else {
parallel::clusterExport(cl, varlist = c("dataset"), envir = environment())
}
list(...)
perf.res <- parallel::parSapply(cl, folds, fold.res, dataset = dataset,
positive.class = positive.class, ...)
parallel::stopCluster(cl)
Ave.res2 <- apply(perf.res, 1, as.numeric)
Ave.res2 <- as.data.frame(t(Ave.res2))
Ave.res2$Ave.Res <- rowMeans(Ave.res2)
message("Average Result:")
print(Ave.res2[ncol(Ave.res2)])
Ave.res2
# perf.res
}
###### svm_tune ######
#' Parameter Tuning of SVM
#' @description This function conduct the parameter tuning of SVM. Parameters
#' gamma and cost can be tuned using grid search.
#'
#' @param dataset The dataset obtained from function \code{\link{extract_features}}.
#' Or datasets used to build the classifier.
#'
#' @param label.col integer specifying the column number of the label. (Default: \code{1})
#'
#' @param positive.class Character. Indicate the positive class of the dataset.
#' (Default: \code{NonCoding}) The value of this parameter should be identical to
#' one of the classes of the response vectors.
#'
#' @param folds.num Integer. Specify the number of folds for cross-validation.
#' (Default: \code{10})
#'
#' @param seed Integer. Used to set the seed for cross-validation. (Default: \code{1})
#'
#' @param gamma.range The range of gamma. (Default: \code{2 ^ seq(-5, 0, 1)})
#'
#' @param cost.range The range of cost. (Default: \code{c(1, 4, 8, 16, 24, 32)})
#'
#' @param return.model Logical. If \code{TRUE}, the function will return the best
#' model trained on the full dataset. If \code{FALSE}, this function will return
#' the optimal parameters.
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}, users can set as \code{-1} to run
#' this function with all cores. If the number of \code{parallel.cores} is more
#' than the \code{folds.num} (number of the folds for cross-validation), the
#' number of \code{parallel.cores} will be set as \code{folds.num} automatically.
#'
#' @param ... Additional arguments for function \code{\link[e1071]{svm}}, except
#' \code{scale}, \code{probability}, \code{kernel}, \code{gamma} and \code{cost}.
#'
#' @return Returns the optimal parameters when \code{return.model = FALSE}.
#' Or returns the best model when \code{return.model = TRUE}.
#'
#' @author HAN Siyu
#'
#' @details During the model tuning, the performance of each combination of
#' parameters will output. Sensitivity, Specificity, Accuracy, F-Measure and Kappa
#' Value are used to evaluate the performances. The best gamma and cost (or best
#' model) are selected based on Accuracy.
#'
#' For the details of parameter gamma and cost, please refer to function
#' \code{\link[e1071]{svm}} of package "e1071".
#'
#' For the details of metrics, please refer to function
#' \code{\link[caret]{confusionMatrix}} of package "caret".
#'
#' @importFrom caret createFolds
#' @importFrom caret confusionMatrix
#' @importFrom e1071 svm
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{extract_features}}, \code{\link{svm_cv}}.
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' positive_data <- extract_features(Seqs[1:5], label = "NonCoding",
#' SS.features = FALSE, format = "DNA",
#' frequencies.file = "human",
#' parallel.cores = 2)
#'
#' negative_data <- extract_features(Seqs[6:10], label = "Coding",
#' SS.features = FALSE, format = "DNA",
#' frequencies.file = "human",
#' parallel.cores = 2)
#'
#' my_dataset <- rbind(positive_data, negative_data)
#'
#' ### Or use our data "demo_dataset"
#' data(demo_dataset)
#' my_dataset <- demo_dataset
#'
#' optimal_parameter <- svm_tune(my_dataset, positive.class = "NonCoding",
#' folds.num = 2, seed = 1,
#' gamma.range = (2 ^ seq(-5, 0, 2)),
#' cost.range = c(1, 8, 16),
#' return.model = FALSE, parallel.core = 2)
#'
#' ### Users can set return.model = TRUE to return the best model.
#' }
#' @export
svm_tune <- function(dataset, label.col = 1, positive.class = "NonCoding",
folds.num = 10, seed = 1,
gamma.range = (2 ^ seq(-5, 0, 1)),
cost.range = c(1, 4, 8, 16, 24, 32),
return.model = TRUE, parallel.cores = 2, ...){
names(dataset)[[label.col]] <- "label"
dataset$label <- as.factor(dataset$label)
set.seed(seed)
folds <- caret::createFolds(dataset$label, k = folds.num, returnTrain = TRUE)
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
parallel.cores <- ifelse(parallel.cores > folds.num, folds.num, parallel.cores)
if(parallel.cores == 2 & folds.num > parallel.cores) {
message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
}
cl <- parallel::makeCluster(parallel.cores)
res <- c()
message("+ SVM.tune processing.")
for(g in gamma.range){
for(C in cost.range){
# parallel::clusterExport(cl, varlist = c("g", "C", "dataset", "positive.class"),
# envir = environment())
message("- gamma = ", g, ", Cost = ", C)
perf.res <- parallel::parSapply(cl, folds, function(x, gamma, cost,
positive.label, ...) {
subset <- dataset[x, ]
test.set <- dataset[-x, ]
svm.mod <- e1071::svm(label ~ ., data = subset, scale = TRUE, probability = TRUE,
kernel = "radial", gamma = gamma, cost = cost,
... = ...)
res <- stats::predict(svm.mod, test.set, probability = TRUE)
confusion.res <- caret::confusionMatrix(data.frame(res)$res, test.set$label,
positive = positive.label, mode = "everything")
performance.res <- data.frame(Sensitivity = confusion.res$byClass[1],
Specificity = confusion.res$byClass[2],
Accuracy = confusion.res$overall[1],
F.Measure = confusion.res$byClass[7],
Kappa = confusion.res$overall[2])
performance.res
},
gamma = g, cost = C,
positive.label = positive.class, ... = ...)
Ave.res <- apply(perf.res, 1, as.numeric)
Ave.res <- as.data.frame(t(Ave.res))
Ave.res$Ave.Res <- rowMeans(Ave.res)
print(t(Ave.res[ncol(Ave.res)]))
res <- c(res, list(Ave.res))
names(res)[length(res)] <- paste("g = ", g, "; C = ", C, sep = "")
}
}
parallel::stopCluster(cl)
message("\n", "Best Result:")
Accuracy <- sapply(res, function(x) x[3,ncol(Ave.res)])
best.res <- res[Accuracy == max(Accuracy)][1]
message("$ ", names(best.res))
print(t(best.res[[1]][ncol(Ave.res)]))
best.gamma <- as.numeric(strsplit(strsplit(names(best.res), "; ")[[1]][[1]], " = ")[[1]][[2]])
best.cost <- as.numeric(strsplit(strsplit(names(best.res), "; ")[[1]][[2]], " = ")[[1]][[2]])
best.parameters <- c(best.gamma = best.gamma, best.cost = best.cost)
if(return.model) {
message("\n", "+ Training the model on the Full Dataset.")
svm.mod <- e1071::svm(label ~ ., data = dataset, scale = TRUE,
probability = TRUE, kernel = "radial",
gamma = best.gamma,
cost = best.cost)
message("\n", "+ SVM.tune completed.")
return(svm.mod)
} else {
message("\n", "+ SVM.tune completed.")
return(list(Best.Parameters = best.parameters, Result = res))
}
}
###### find_orfs ######
#' Find ORFs
#' @description This function can find all the ORFs in one sequence.
#'
#' @param OneSeq Is one sequence. Can be a FASTA file read by package "seqinr"
#' \code{\link[seqinr]{seqinr-package}} or just a string.
#'
#' @param reverse.strand Logical. Whether find ORF on the reverse strand. Default: \code{FALSE}
#'
#' @param max.only Logical. If \code{TRUE}, only the longest ORF will be returned. Default: \code{TRUE}
#'
#' @return If \code{max.only = TRUE}, the function returns a list which consists the ORF region (\code{ORF.Max.Seq}),
#' length (\code{ORF.Max.Len}) and coverage (\code{ORF.Max.Cov}) of the longest ORF.
#' If \code{max.only = FALSE}, the function returns a dataframe which consists all the ORF sequences.
#' @author HAN Siyu
#' @details This function can extract ORFs of one sequence. It returns
#' ORF region, length and coverage of the longest ORF when \code{max.only = TRUE} or
#' ORF region, start position, end position, length and coverage of all the ORFs when
#' \code{max.only = FALSE}. Coverage is the the ratio
#' of the ORF to transcript length. If \code{reverse.strand = TRUE}, ORF will also be
#' found on reverse strand.
#' @importFrom seqinr getSequence
#' @importFrom seqinr comp
#' @importFrom seqinr s2c
#' @examples
#' ### For one sequence:
#' OneSeq <- c("cccatgcccagctagtaagcttagcc")
#' orf.info_1 <- find_orfs(OneSeq, reverse.strand = TRUE, max.only = FALSE)
#'
#' ### For a FASTA file contains several sequences:
#' \dontrun{
#' ### Use "read.fasta" function of package "seqinr" to read a FASTA file:
#' Seqs <- seqinr::read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#' }
#'
#' ### Or just try to use our data "demo_DNA.seq"
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' ### Use apply function to find the longest ORF:
#' orf.info_2 <- sapply(Seqs, find_orfs, reverse.strand = FALSE, max.only = FALSE)
#' @export
find_orfs <- function(OneSeq, reverse.strand = FALSE, max.only = TRUE) {
orf.info <- find_ORF(OneSeq, max.only = max.only)
if(reverse.strand) {
OneSeq <- unlist(seqinr::getSequence(OneSeq, as.string = TRUE))
OneSeq <- gsub("\n", "", OneSeq)
OneSeq <- seqinr::s2c(OneSeq)
Seq.reverse <- rev(seqinr::comp(OneSeq))
orf.reverse <- find_ORF(Seq.reverse, max.only = max.only)
orf.info <- list(ORF.Forward = orf.info,
ORF.Reverse = orf.reverse)
}
orf.info
}
###### run_RNAfold ######
#' Obtain the Secondary Structure Sequences Using RNAfold
#' @description This function can compute secondary structure sequences. The tool
#' "RNAfold" of software "ViennaRNA" is required for this function.
#'
#' @param Sequences A FASTA file loaded by function \code{\link[seqinr]{read.fasta}} of
#' \code{\link[seqinr]{seqinr-package}}.
#'
#' @param RNAfold.path String. Indicate the path of the program "RNAfold". By
#' default is \code{"RNAfold"} for UNIX/Linux system. (See details.)
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}, users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return Returns data.frame. The first row is RNA sequence; the second row is
#' Dot-Bracket Notation of secondary structure sequences; the last row is minimum
#' free energy (MFE).
#' @author HAN Siyu
#' @details This function is used to compute secondary structure. The output of
#' this function can be used in function \code{\link{make_frequencies}},
#' \code{\link{extract_features}}, \code{\link{build_model}} and
#' \code{\link{lnc_finder}} when parameter \code{SS.features} is set as \code{TRUE}.
#'
#' This function depends on the program "RNAfold" of software "ViennaRNA".
#' (\url{http://www.tbi.univie.ac.at/RNA/index.html})
#'
#' Parameter \code{RNAfold.path} can be simply defined as \code{"RNAfold"} as
#' default when the OS is UNIX/Linux. However, for some OS, such as Windows, users
#' need to specify the \code{RNAfold.path} if the path of "RNAfold" haven't been
#' added in environment variables.
#'
#' This function can print the related information when the OS is UNIX/Linux,
#' such as:
#'
#' \code{"25 of 100, length: 695 nt"},
#'
#' which means around 100 sequences are assigned to this node and the program is
#' computing the 25th sequence. The length of this sequence is 695nt.
#'
#' If users have their own SS data, users can use function \code{\link{read_SS}} to load
#' them, instead of obtaining from RNAfold.
#'
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{read_SS}}
#' @examples
#' \dontrun{
#' ### For a FASTA file contains several sequences,
#' ### Use "read.fasta" function of package "seqinr" to read a FASTA file:
#' Seqs <- read.fasta(file =
#' "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt")
#'
#' ### Or just try to use our data "demo_DNA.seq"
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' ### Windows:
#' RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"'
#' SS.seq_1 <- run_RNAfold(Seqs[1:2], RNAfold.path = RNAfold.path, parallel.cores = 2)
#'
#' ### For UNIX/Linux, "RNAfold.path" can be just defined as "RNAfold" as default:
#' SS.seq_2 <- run_RNAfold(Seqs, RNAfold.path = "RNAfold", parallel.cores = 2)
#' }
#' @export
run_RNAfold <- function(Sequences, RNAfold.path = "RNAfold",
parallel.cores = 2){
Seqs.validate <- Sequences[which(lengths(Sequences) < 30000)]
if(length(Seqs.validate) < length(Sequences)){
message("Due to the limitation of RNAfold,")
message("Sequences with length more than 30000 nt will be omitted.")
message(length(Sequences) - length(Seqs.validate), " sequences have been removed.", "\n")
Sequences <- Seqs.validate
}
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores, outfile = "")
message("\n", "Sequences Number: ", length(Sequences), "\n")
message("Processing...", "\n")
index <- 1
info <- paste(ceiling(length(Sequences) / parallel.cores), ",", sep = "")
parallel::clusterExport(cl, varlist = c("info", "index"), envir = environment())
sec.seq <- parallel::parSapply(cl, Sequences, secondary_seq, info = info,
RNAfold.path = RNAfold.path)
parallel::stopCluster(cl)
sec.seq <- data.frame(sec.seq, stringsAsFactors = FALSE)
message("\n", "Completed.", "\n")
sec.seq
}
###### read_SS ######
#' Read Secondary Structure Information
#' @description This function can read secondary structure information from your
#' own file instead of obtaining from function \code{\link{run_RNAfold}}. This function
#' will be useful if users have had secondary structure sequences (Dot-Bracket Notation).
#'
#' @param oneFile.loc String. The location of your sequence file. This file should contains
#' one (and only one) RNA sequence and its secondary structure sequence in Dot-Bracket Notation.
#' This parameter needs to be defined only when \code{separateFile = FALSE}. See Details for more
#' information.
#'
#' @param seqRNA.loc String. The location of your RNA sequences file (FASTA format). If your
#' RNA sequences and secondary structure sequences are in two files, you need to define the
#' locations of two files respectively. And the files with multiple sequences are supported
#' for this option. This parameter needs to be defined only when \code{separateFile} is \code{TRUE}.
#' Location of secondary structure sequences file is also needed (parameter \code{seqSS.loc}).
#' See Details for more information.
#'
#' @param seqSS.loc String. The location of your secondary structure sequences file (FASTA format).
#'
#' @param separateFile Logical. Your RNA sequence(s) and secondary structure sequence(s) are in
#' separate files? If \code{separateFile = FALSE}, your file should have one (and only one) RNA
#' sequence and its secondary structure sequence. No limit when \code{separateFile = TRUE}.
#'
#' @param withMFE Logical. Whether MFE is provided at the end of secondary structure sequence.
#' If \code{withMFE = TRUE}, MFE will be extracted. The format should be in accordance with
#' the output format of RNAfold.
#'
#' @return A dataframe. The first row is RNA sequence, the second row is Dot-Bracket Notation of
#' secondary structure sequence, the third row is MFE (if MFE is provided).
#'
#' @author HAN Siyu
#'
#' @details When users want to predict sequences with secondary structure features, users may have
#' had their own secondary structure sequences. With this function, users can read SS information
#' from their files. Two kind of files are supported: RNA sequence and SS sequence in one file
#' \code{separateFile} is \code{FALSE} or in separate files \code{separateFile = TRUE}.
#'
#' \code{separateFile = FALSE} is used for secondary structure that obtained from some popular
#' programs, such as RNAfold. In this case, the output file only contains one RNA sequence and
#' its SS. Besides, this file only have two rows: RNA sequence and its SS sequences. Thus, this
#' option is more favorable when the file only have one sequence and the sequence are in accordance
#' with the output format of RNAfold.
#'
#' If users obtained the SS sequence from experiments, RNA sequence and SS sequence may be in two
#' files. In this case, users can select \code{separateFile = TRUE}. Two files should be in FASTA
#' format and one file can have multiple sequences. The sequences in two files should have the same
#' order. If your data are obtained from experiments or other sources, it is highly recommended
#' that users should build new model with this data, since the SS sequences of pre-built model are
#' obtained for RNAfold and may have many differences with experimental data.
#'
#' @importFrom seqinr read.fasta
#' @importFrom seqinr getSequence
#' @seealso \code{\link{run_RNAfold}}
#' @examples
#' \dontrun{
#' ### Load sequence data
#' data("demo_DNA.seq")
#' Seqs <- demo_DNA.seq[1:4]
#' ### Convert sequences from vector to string.
#' Seqs <- sapply(Seqs, seqinr::getSequence, as.string = TRUE)
#' ### Write a fasta file.
#' seqinr::write.fasta(Seqs, names = names(Seqs), file.out = "tmp.RNA.fa", as.string = TRUE)
#'
#' ### For Windows system: (Your path of RNAfold.)
#' RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"'
#' ### Define the parameters of RNAfold. See documents of RNAfold for more information.
#' RNAfold.command <- paste(RNAfold.path, " --noPS -i tmp.RNA.fa -o output", sep = "")
#' ### Run RNAfold and output four result files.
#' system(RNAfold.command)
#'
#' ### Read secondary structure information for one file.
#' result_1 <- read_SS(oneFile.loc = "output_ENST00000510062.1.fold",
#' separateFile = FALSE, withMFE = TRUE)
#' ### Read secondary sturcture sequences for multiple files.
#' filePath <- dir(pattern = ".fold")
#' result_2 <- sapply(filePath, read_SS, separateFile = FALSE, withMFE = TRUE)
#' result_2 <- as.data.frame(result_2)
#' }
#'
#' @export
#'
read_SS <- function(oneFile.loc, seqRNA.loc, seqSS.loc, separateFile = TRUE, withMFE = TRUE) {
if(separateFile) {
RNA.seq <- seqinr::read.fasta(seqRNA.loc, as.string = TRUE)
SS.seq <- seqinr::read.fasta(seqSS.loc, as.string = TRUE)
if(!all(names(RNA.seq) == names(SS.seq))) stop("Cannot match the names of two files.")
RNA.row <- sapply(RNA.seq, seqinr::getSequence, as.string = TRUE)
SS.row <- sapply(SS.seq, seqinr::getSequence, as.string = TRUE)
if(withMFE) {
seq.ss <- mapply(function(RNA, SS) {
X1 <- RNA
X3 <- as.numeric(substr(SS, nchar(RNA) + 3, nchar(SS) -1))
X2 <- substr(SS, 1, nchar(RNA))
out <- c(X1, X2, X3)
}, RNA.row, SS.row)
out <- data.frame(seq.ss, stringsAsFactors = FALSE)
} else {
RNA.Seq <- unlist(RNA.row)
SS.Seq <- unlist(SS.row)
out <- data.frame(rbind(RNA.Seq, SS.Seq), stringsAsFactors = FALSE)
}
} else {
readFile <- scan(oneFile.loc, what = character(), sep = "\n", quiet = TRUE)
# if(length(readFile) > 3) message("If separateFile = FALSE, only one sequence will be read.")
# if(substr(readFile[[1]], 1, 1) == ">") seqName <- substring(readFile[[1]], 2)
if(withMFE) {
X1 <- readFile[[1]]
X3 <- as.numeric(substr(readFile[[2]], nchar(readFile[[1]]) + 3, nchar(readFile[[2]]) -1))
X2 <- substr(readFile[[2]], 1, nchar(readFile[[1]]))
out <- rbind(X1, X2, X3)
out <- data.frame(sequence = out, stringsAsFactors = FALSE)
} else out <- data.frame(sequence = readFile, stringsAsFactors = FALSE)
}
out
}
###### make_frequencies ######
#' Make the frequencies file for new classifier construction
#' @description This function is used to calculate the frequencies of lncRNAs, CDs, and
#' secondary structure sequences. The frequencies file can be used to build the classifier
#' using function \code{\link{extract_features}}. Functions \code{make_frequencies} and
#' \code{extract_features} are useful when users are trying
#' to build their own model.
#'
#' NOTE: Function \code{make_frequencies} makes the frequencies file
#' for building the classifiers of LncFinder method. If users need to calculate Logarithm-Distance,
#' Euclidean-Distance, and hexamer score, the frequencies file need to be computed using function
#' \code{\link{make_referFreq}}.
#'
#' @param cds.seq Coding sequences (mRNA without UTRs). Can be a FASTA file loaded
#' by \code{\link[seqinr]{seqinr-package}} or secondary structure
#' sequences (Dot-Bracket Notation) obtained form function \code{\link{run_RNAfold}}.
#' CDs are used to calculate hexamer frequencies of nucleotide sequences,thus
#' secondary structure is not needed. Parameter \code{cds.format} should be
#' \code{"SS"} when input is secondary structure sequences. (See details for
#' more information.)
#'
#' @param mRNA.seq mRNA sequences with Dot-Bracket Notation. The secondary
#' structure sequences can be obtained from function \code{\link{run_RNAfold}}.
#' mRNA sequences are used to calculate the frequencies of acgu-ACGU and a acguD
#' (see details), thus, mRNA sequences are required only when \code{SS.features = TRUE}.
#'
#' @param lncRNA.seq Long non-coding RNA sequences. Can be a FASTA file loaded by
#' \code{\link[seqinr]{seqinr-package}} or secondary structure
#' sequences (Dot-Bracket Notation) obtained from function \code{\link{run_RNAfold}}.
#' If \code{SS.features = TRUE}, \code{lncRNA.seq} must be RNA sequences with
#' secondary structure sequences and parameter \code{lnc.format} should be defined
#' as \code{"SS"}.
#'
#' @param SS.features Logical. If \code{SS.features = TRUE}, frequencies of secondary
#' structure will also be calculated and the model can be built with secondary
#' structure features. In this case, \code{mRNA.seq} and \code{lncRNA.seq} should
#' be secondary structure sequences.
#'
#' @param cds.format String. Define the format of the sequences of \code{cds.seq}.
#' Can be \code{"DNA"} or \code{"SS"}. \code{"DNA"} for DNA sequences and \code{"SS"}
#' for secondary structure sequences.
#'
#' @param lnc.format String. Define the format of lncRNAs (\code{lncRNA.seq}).
#' Can be \code{"DNA"} or \code{"SS"}. \code{"DNA"} for DNA sequences and \code{"SS"}
#' for secondary structure sequences. This parameter must be defined as \code{"SS"}
#' when \code{SS.features = TURE}.
#'
#' @param check.cds Logical. Incomplete CDs can lead to a false shift and a
#' inaccurate hexamer frequencies. When \code{check.cds = TRUE}, hexamer frequencies
#' will be calculated on the longest ORF. This parameter is strongly recommended to
#' set as \code{TRUE} when mRNA is used as CDs.
#'
#' @param ignore.illegal Logical. If \code{TRUE}, the sequences with non-nucleotide
#' characters (nucleotide characters: "a", "c", "g", "t") will be ignored when
#' calculating hexamer frequencies.
#'
#' @return Returns a list which consists the frequencies of protein-coding sequences
#' and non-coding sequences.
#' @author HAN Siyu
#'
#' @details This function is used to make frequencies file for LncFinder method. This file is needed
#' when users are trying to build their own model.
#'
#' In order to achieve high accuracy, mRNA should not be regarded as CDs and assigned
#' to parameter \code{cds.seq}. However, CDs of some species may be insufficient
#' for calculating frequencies, and mRNAs can be regarded as CDs with parameter
#' \code{check.cds = TRUE}. In this case, hexamer frequencies will be calculated
#' on ORF region.
#'
#' Considering that it is time consuming to obtain secondary structure sequences,
#' users can only provide nucleotide sequences and build a model without secondary
#' structure features (\code{SS.features = } \code{FALSE}). If users want to build a model
#' with secondary structure features, parameter \code{SS.features} should be set
#' as \code{TRUE}. At the same time, the format of the sequences of \code{mRNA.seq}
#' and \code{lnc.seq} should be secondary structure sequences (Dot-Bracket Notation).
#' Secondary structure sequences can be obtained by function \code{\link{run_RNAfold}}.
#'
#' Please note that:
#'
#' SS.features can improve the performance when the species of unevaluated sequences
#' is identical to the species of the sequences that used to build the model.
#'
#' However, if users are trying to predict sequences with the model trained on
#' other species, SS.features may lead to low accuracy.
#'
#' The frequencies file consists three groups: Hexamer Frequencies; acgu-ACGU
#' Frequencies and acguD Frequencies.
#'
#' Hexamer Frequencies are calculated on the original nucleotide sequences by
#' employing \emph{k}-mer scheme (\emph{k} = 6), and the sliding window will slide
#' 3 nt each step.
#'
#' For any secondary structure sequences (Dot-Bracket Notation), if one position
#' is a dot, the corresponding nucleotide of the RNA sequence will be replaced
#' with character "D". acguD Frequencies are the \emph{k}-mer frequencies
#' (\emph{k} = 4) calculated on this new sequences.
#'
#' Similarly, for any secondary structure sequences (Dot-Bracket Notation), if
#' one position is "(" or ")", the corresponding nucleotide of the RNA sequence
#' will be replaced with upper case ("A", "C", "G", "U").
#'
#' A brief example,
#'
#' DNA Sequence:\code{ 5'- t a c a g t t a t g -3'}
#'
#' RNA Sequence:\code{ 5'- u a c a g u u a u g -3'}
#'
#' Dot-Bracket Sequence:\code{ 5'- . . . . ( ( ( ( ( ( -3'}
#'
#' acguD Sequence:\code{ \{ D, D, D, D, g, u, u, a, u, g \}}
#'
#' acgu-ACGU Sequence:\code{ \{ u, a, c, a, G, U, U, A, U, G \}}
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @seealso \code{\link{run_RNAfold}}, \code{\link{read_SS}},
#' \code{\link{build_model}}, \code{\link{extract_features}},
#' \code{\link{make_referFreq}}.
#' @examples
#' ### Only for examples:
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' \dontrun{
#' ### Obtain the secondary structure sequences (Windows OS):
#' RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"'
#' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2)
#'
#' ### Make frequencies file with secondary strucutre features,
#' my_file_1 <- make_frequencies(cds.seq = SS.seq, mRNA.seq = SS.seq,
#' lncRNA.seq = SS.seq, SS.features = TRUE,
#' cds.format = "SS", lnc.format = "SS",
#' check.cds = TRUE, ignore.illegal = FALSE)
#' }
#'
#' ### Make frequencies file without secondary strucutre features,
#' my_file_2 <- make_frequencies(cds.seq = Seqs, lncRNA.seq = Seqs,
#' SS.features = FALSE, cds.format = "DNA",
#' lnc.format = "DNA", check.cds = TRUE,
#' ignore.illegal = FALSE)
#'
#' ### The input of cds.seq and lncRNA.seq can also be secondary structure
#' ### sequences when SS.features = FALSE, such as,
#' data(demp_SS.seq)
#' SS.seq <- demo_SS.seq
#' my_file_3 <- make_frequencies(cds.seq = SS.seq, lncRNA.seq = Seqs,
#' SS.features = FALSE, cds.format = "SS",
#' lnc.format = "DNA", check.cds = TRUE,
#' ignore.illegal = FALSE)
#' @export
make_frequencies <- function(cds.seq, mRNA.seq, lncRNA.seq, SS.features = FALSE,
cds.format = "DNA", lnc.format = "DNA", check.cds = TRUE,
ignore.illegal = TRUE) {
if(SS.features & lnc.format != "SS") stop("Error: Secondary structure file is required for the selected mode.")
message("+ Check the format of sequences. ", Sys.time(), "\n")
if(lnc.format == "DNA") {
lnc.DNA <- lncRNA.seq
} else if(lnc.format == "SS") {
lnc.DNA <- lapply(lncRNA.seq, get.Seq_DNA)
} else stop("- Error: Wrong format name of lncRNA.")
if(cds.format == "DNA") {
cds.DNA <- cds.seq
} else if(cds.format == "SS") {
cds.DNA <- lapply(cds.seq, get.Seq_DNA)
} else stop("- Error: Wrong format name of CDs.")
if(SS.features) {
message("+ Calculating frequencies of Secondary structure:")
message("- Processing sequences.")
lnc.acguD <- lapply(lncRNA.seq, get.Seq_acguD)
pct.acguD <- lapply(mRNA.seq, get.Seq_acguD)
lnc.SS <- lapply(lncRNA.seq, get.Seq_acguACGU)
pct.SS <- lapply(mRNA.seq, get.Seq_acguACGU)
message("- Calculating frequencies of acguD k = 4", "\n")
message(" Non-coding sequences")
lnc.acguD.freq <- get.freq(lnc.acguD, alphabet = c("a", "c", "g", "u", "D"),
wordsize = 4, step = 1, freq = T, ignore.illegal = FALSE)
message(" Completed.", "\n")
message(" Coding sequences")
pct.acguD.freq <- get.freq(pct.acguD, alphabet = c("a", "c", "g", "u", "D"),
wordsize = 4, step = 1, freq = T, ignore.illegal = FALSE)
message(" Completed.", "\n")
message("- Calculating frequencies of acguACGU k = 3", "\n")
message(" Non-coding sequences")
lnc.acguACGU.freq <- get.freq(lnc.SS, alphabet = c("A", "C", "G", "U", "a", "c", "g", "u"),
wordsize = 3, step = 1, freq = T, ignore.illegal = FALSE)
message(" Completed.", "\n")
message(" Coding sequences")
pct.acguACGU.freq <- get.freq(pct.SS, alphabet = c("A", "C", "G", "U", "a", "c", "g", "u"),
wordsize = 3, step = 1, freq = T, ignore.illegal = FALSE)
message(" Completed.", "\n")
}
message("+ Calculating frequencies of DNA k = 6")
if(check.cds) {
message("- Processing CDs sequences.")
orf.seq <- lapply(cds.DNA, function(x) {
orf.info <- find_ORF(x)
if(orf.info[[1]] >= 12) orf <- seqinr::s2c(orf.info[[3]]) else orf <- NA
orf
})
cds.DNA <- orf.seq[!is.na(orf.seq)]
message("- Calculating frequencies.")
}
message("\n", " Non-coding sequences")
lnc.DNA.freq <- get.freq(lnc.DNA, alphabet = c("a", "c", "g", "t"), wordsize = 6,
step = 3, freq = F, ignore.illegal = ignore.illegal)
message(" Completed.", "\n")
message(" Coding sequences")
cds.DNA.freq <- get.freq(cds.DNA, alphabet = c("a", "c", "g", "t"), wordsize = 6,
step = 3, freq = F, ignore.illegal = ignore.illegal)
message(" Completed.", "\n")
message("+ Frequencies calculation completed. ", Sys.time())
if(SS.features) {
Internal.freq <- list(DNA.lnc = lnc.DNA.freq,
DNA.cds = cds.DNA.freq,
acguD.lnc = lnc.acguD.freq,
acguD.pct = pct.acguD.freq,
acguACGU.lnc = lnc.acguACGU.freq,
acguACGU.pct = pct.acguACGU.freq)
} else {
Internal.freq <- list(DNA.lnc = lnc.DNA.freq,
DNA.cds = cds.DNA.freq)
}
Internal.freq
}
###### extract_features ######
#' Extract the Features
#' @description This function can construct the dataset. This function is only used
#' to extract the features, please use function \code{\link{build_model}} to build
#' new models.
#'
#' @param Sequences mRNA sequences or long non-coding sequences. Can be a FASTA
#' file loaded by \code{\link[seqinr]{seqinr-package}} or
#' secondary structure sequences (Dot-Bracket Notation) obtained from function
#' \code{\link{run_RNAfold}}. If \code{Sequences} are secondary structure
#' sequences file, parameter \code{format} should be defined as \code{"SS"}.
#'
#' @param label Optional. String. Indicate the label of the sequences such as
#' "NonCoding", "Coding".
#'
#' @param SS.features Logical. If \code{SS.features = TRUE}, secondary structure
#' features will be extracted. In this case, \code{Sequences} should be secondary
#' structure sequences (Dot-Bracket Notation) obtained from function
#' \code{\link{run_RNAfold}} and parameter \code{format} should be set as \code{"SS"}.
#'
#' @param format String. Can be \code{"DNA"} or \code{"SS"}. Define the format of
#' \code{Sequences}. \code{"DNA"} for DNA sequences and \code{"SS"} for secondary
#' structure sequences. This parameter must be set as \code{"SS"} when
#' \code{SS.features = TURE}.
#'
#' @param frequencies.file String or a list obtained from function
#' \code{\link{make_frequencies}}. Input species name \code{"human"}, \code{"mouse"}
#' or \code{"wheat"} to use pre-build frequencies files. Or assign a users' own
#' frequencies file (See function \code{\link{make_frequencies}}).
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return Returns a data.frame. 11 features when \code{SS.features} is \code{FALSE},
#' and 19 features when \code{SS.features} is \code{TRUE}.
#'
#' @author HAN Siyu
#' @details This function extracts the features and constructs the dataset.
#'
#' Considering that it is time consuming to obtain secondary structure sequences,
#' users can build the model only with features of sequence and EIIP
#' (\code{SS.features = FALSE}). When \code{SS.features = TRUE}, \code{Sequences}
#' should be secondary structure sequences (Dot-Bracket Notation) obtained from
#' function \code{\link{run_RNAfold}} and parameter \code{format} should be set
#' as \code{"SS"}.
#'
#' Please note that:
#'
#' Secondary structure features (\code{SS.features}) can improve the performance
#' when the species of unevaluated sequences is identical to the species of the
#' sequences that used to build the model.
#'
#' However, if users are trying to predict sequences with the model trained on
#' other species, \code{SS.features} as \code{TRUE} may lead to low accuracy.
#'
#' @section Features:
#' 1. Features based on sequence:
#'
#' The length and coverage of the longest ORF (\code{ORF.Max.Len} and
#' \code{ORF.Max.Cov});
#'
#' Log-Distance.lncRNA (\code{Seq.lnc.Dist});
#'
#' Log-Distance.protein-coding transcripts (\code{Seq.pct.Dist});
#'
#' Distance-Ratio.sequence (\code{Seq.Dist.Ratio}).
#'
#'
#' 2. Features based on EIIP (electron-ion interaction pseudopotential) value:
#'
#' Signal at 1/3 position (\code{Signal.Peak});
#'
#' Signal to noise ratio (\code{SNR});
#'
#' the minimum value of the top 10\% power spectrum (\code{Signal.Min});
#'
#' the quantile Q1 and Q2 of the top 10\% power spectrum (\code{Singal.Q1}
#' and \code{Signal.Q2})
#'
#' the maximum value of the top 10\% power spectrum (\code{Signal.Max}).
#'
#'
#' 3. Features based on secondary structure sequence:
#'
#' Log-Distance.acguD.lncRNA (\code{Dot_lnc.dist});
#'
#' Log-Distance.acguD.protein-coding transcripts (\code{Dot_pct.dist});
#'
#' Distance-Ratio.acguD (\code{Dot_Dist.Ratio});
#'
#' Log-Distance.acgu-ACGU.lncRNA (\code{SS.lnc.dist});
#'
#' Log-Distance.acgu-ACGU.protein-coding transcripts (\code{SS.pct.dist});
#'
#' Distance-Ratio.acgu-ACGU (\code{SS.Dist.Ratio});
#'
#' Minimum free energy (\code{MFE});
#'
#' Percentage of Unpair-Pair (\code{UP.PCT})
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{svm_tune}}, \code{\link{build_model}},
#' \code{\link{make_frequencies}}, \code{\link{run_RNAfold}}, \code{\link{read_SS}}.
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' ### Extract features with pre-build frequencies.file:
#' my_features <- extract_features(Seqs, label = "Class.of.the.Sequences",
#' SS.features = FALSE, format = "DNA",
#' frequencies.file = "mouse",
#' parallel.cores = 2)
#'
#' ### Use your own frequencies file by assign frequencies list to parameter
#' ### "frequencies.file".
#' }
#' @export
extract_features <- function(Sequences, label = NULL, SS.features = FALSE, format = "DNA",
frequencies.file = "human", parallel.cores = 2) {
if(SS.features & format != "SS") stop("Error: Secondary structure file is required for the selected mode.")
message("+ Check the format of sequences. ", Sys.time(), "\n")
if(format == "DNA") {
DNA.seq <- Sequences
} else if(format == "SS") {
DNA.seq <- lapply(Sequences, get.Seq_DNA)
} else stop("- Error: Wrong format name.")
if(is.character(frequencies.file)) { # class(frequencies.file) == "character"
if(frequencies.file == "human") {
Internal.data = Internal.human
} else if(frequencies.file == "mouse") {
Internal.data = Internal.mouse
} else if(frequencies.file == "wheat") {
Internal.data = Internal.wheat
} else stop("- Error: Wrong frequencies.file name.")
} else Internal.data = frequencies.file
if (parallel.cores == 2) message("Users can try to set parallel.cores = -1 to use all cores!", "\n")
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
cl <- parallel::makeCluster(parallel.cores)
parallel::clusterExport(cl, varlist = c("Internal.data", "find_ORF"), envir = environment())
if(SS.features) {
message("+ Extracting secondary structure features:")
message("- Processing sequences.")
UP.seq <- lapply(Sequences, get.Seq_UP)
SS.seq <- lapply(Sequences, get.Seq_acguACGU)
acguD.seq <- lapply(Sequences, get.Seq_acguD)
message("- LogDist.acguD k = 4")
acguD <- parallel::parSapply(cl, acguD.seq, LogDist.acguD,
wordsize = 4, step = 1,
hexamer.lnc = Internal.data$acguD.lnc,
hexamer.cds = Internal.data$acguD.pct)
message("- LogDist.acguACGU k = 3")
acguACGU <- parallel::parSapply(cl, SS.seq, LogDist.acguACGU,
wordsize = 3, step = 1,
hexamer.lnc = Internal.data$acguACGU.lnc,
hexamer.cds = Internal.data$acguACGU.pct)
message("- MFE")
MFE <- as.numeric(as.character(Sequences[3,]))
message("- Percentage of Unpair-Pair", "\n")
UP.percentage <- parallel::parSapply(cl, UP.seq, seqinr::count,
wordsize = 2, freq = TRUE,
alphabet = c("U", "P"))
SS.group <- data.frame(t(acguD), t(acguACGU), MFE = MFE, UP.PCT = UP.percentage[3,])
}
message("+ Extracting sequence and EIIP features:")
message("- ORF and LogDist.Seq k = 6")
Seq.ORF <- parallel::parSapply(cl, DNA.seq, LogDist.DNA, wordsize = 6, step = 3,
hexamer.lnc = Internal.data$DNA.lnc,
hexamer.cds = Internal.data$DNA.cds)
message("- EIIP", "\n")
EIIP.DFT <- parallel::parSapply(cl, DNA.seq, EIIP.DFT)
parallel::stopCluster(cl)
features <- data.frame(t(Seq.ORF), t(EIIP.DFT))
message("+ Feature extraction completed. ", Sys.time(), "\n")
if(SS.features) features <- cbind(features, SS.group)
if(!is.null(label)) features <- cbind(label, features)
features
}
###### build_model ######
#' Build Users' Own Model
#' @description This function is used to build new models with users' own data.
#'
#' @param lncRNA.seq Long non-coding sequences. Can be a FASTA file loaded by
#' \code{\link[seqinr]{seqinr-package}} or secondary structure
#' sequences file (Dot-Bracket Notation) obtained from function
#' \code{\link{run_RNAfold}}. If \code{lncRNA.seq} is secondary structure
#' sequences file, parameter \code{lncRNA.format} should be defined as \code{"SS"}.
#'
#' @param mRNA.seq mRNA sequences. FASTA file loaded by \code{\link[seqinr]{read.fasta}} or
#' secondary structure sequences (Dot-Bracket Notation) obtained from function
#' \code{\link{run_RNAfold}}. If \code{mRNA.seq} is secondary structure sequences
#' file, parameter \code{mRNA.format} should be defined as \code{"SS"}.
#'
#' @param frequencies.file String or a list obtained from function
#' \code{\link{make_frequencies}}. Input species name \code{"human"},
#' \code{"mouse"} or \code{"wheat"} to use pre-build frequencies files. Or assign
#' a users' own frequencies file (Please refer to function
#' \code{\link{make_frequencies}} for more information).
#'
#' @param SS.features Logical. If \code{SS.features = TRUE}, secondary structure
#' features will be used to build the model. In this case, \code{lncRNA.seq} and
#' \code{mRNA.seq} should be secondary structure sequences (Dot-Bracket Notation)
#' obtained from function \code{\link{run_RNAfold}} and parameter
#' \code{lncRNA.format} and \code{mRNA.format} should be set as \code{"SS"}.
#'
#' @param lncRNA.format String. Define the format of \code{lncRNA.seq}. \code{"DNA"}
#' for DNA sequences and \code{"SS"} for secondary structure sequences. Only when
#' both \code{mRNA.format} and \code{lncRNA.format} are set as \code{"SS"}, can
#' the model with secondary structure features be built (\code{SS.features = TRUE}).
#'
#' @param mRNA.format String. Define the format of \code{mRNA.seq}. Can be
#' \code{"DNA"} or \code{"SS"}. \code{"DNA"} for DNA sequences and \code{"SS"}
#' for secondary structure sequences. When this parameter is defined as \code{"DNA"},
#' only the model without secondary structure features can be built. In this case,
#' parameter \code{SS.features} should be set as \code{FALSE}.
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}, users can set as \code{-1} to run
#' this function with all cores. During the process of svm tuning, if the number
#' of \code{parallel.cores} is more than the \code{folds.num} (number of the folds
#' for cross-validation), the number of \code{parallel.cores} will be set as
#' \code{folds.num} automatically.
#'
#' @param folds.num Integer. Specify the number of folds for cross-validation.
#' (Default: \code{10})
#'
#' @param seed Integer. Used to set the seed for cross-validation. (Default: \code{1})
#'
#' @param gamma.range The range of gamma. (Default: \code{2 ^ seq(-5, 0, 1)})
#'
#' @param cost.range The range of cost. (Default: \code{c(1, 4, 8, 16, 24, 32)})
#'
#' @param ... Additional arguments passed to function \code{\link{svm_tune}} for customised SVM model training.
#'
#' @return Returns a svm model.
#'
#' @author HAN Siyu
#'
#' @details This function is used to build a new model with users' own sequences.
#' Users can use function \code{\link{lnc_finder}} to predict the sequences with
#' new models.
#'
#' For the details of \code{frequencies.file}, please refer to function
#' \code{\link{make_frequencies}}.
#'
#' For the details of the features, please refer to function
#' \code{\link{extract_features}}.
#'
#' For the details of svm tuning, please refer to function \code{\link{svm_tune}}.
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom caret createFolds
#' @importFrom caret confusionMatrix
#' @importFrom e1071 svm
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{make_frequencies}}, \code{\link{lnc_finder}},
#' \code{\link{extract_features}}, \code{\link{svm_tune}},
#' \code{\link[e1071]{svm}}.
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' ### Build the model with pre-build frequencies.file:
#' my_model <- build_model(lncRNA.seq = Seqs[1:5], mRNA.seq = Seqs[6:10],
#' frequencies.file = "human", SS.features = FALSE,
#' lncRNA.format = "DNA", mRNA.format = "DNA",
#' parallel.cores = 2, folds.num = 2, seed = 1,
#' gamma.range = (2 ^ seq(-5, -1, 2)),
#' cost.range = c(2, 6, 12, 20))
#'
#' ### Users can use default values of gamma.range and cost.range to find the
#' ### best parameters.
#' ### Use your own frequencies file by assigning frequencies list to parameter
#' ### "frequencies.file".
#' }
#' @export
build_model <- function(lncRNA.seq, mRNA.seq, frequencies.file, SS.features = FALSE,
lncRNA.format = "DNA", mRNA.format = "DNA", parallel.cores = 2,
folds.num = 10, seed = 1, gamma.range = (2 ^ seq(-5, 0, 1)),
cost.range = c(1, 4, 8, 16, 24, 32), ...) {
message("+ Extract features of non-coding sequences.")
lnc.data <- extract_features(lncRNA.seq, label = "NonCoding", SS.features = SS.features,
format = lncRNA.format, frequencies.file = frequencies.file,
parallel.cores = parallel.cores)
message("+ Extract features of protein-coding sequences.")
pct.data <- extract_features(mRNA.seq, label = "Coding", SS.features = SS.features,
format = mRNA.format, frequencies.file = frequencies.file,
parallel.cores = parallel.cores)
dataset <- rbind(lnc.data, pct.data)
dataset$label <- as.factor(dataset$label)
svm.mod <- svm_tune(dataset, gamma.range = gamma.range, cost.range = cost.range,
seed = seed, folds.num = folds.num, return.model = TRUE,
parallel.cores = parallel.cores, ... = ...)
# message("+ Build the model with the whole dataset.")
# svm.mod <- e1071::svm(label ~ ., data = dataset, scale = TRUE, probability = TRUE, kernel = "radial",
# gamma = best.parameters[[1]][[1]], cost = best.parameters[[1]][[2]])
message("+ Process completed.")
svm.mod
}
###### lnc_finder ######
#' Long Non-coding RNA Identification
#' @description This function is used to predict sequences are non-coding transcripts
#' or protein-coding transcripts.
#'
#' @param Sequences Unevaluated sequences. Can be a FASTA file loaded by
#' \code{\link[seqinr]{seqinr-package}} or secondary structure sequences
#' (Dot-Bracket Notation) obtained from function \code{\link{run_RNAfold}}. If
#' \code{Sequences} is secondary structure sequences file, parameter \code{format}
#' should be defined as \code{"SS"}.
#'
#' @param SS.features Logical. If \code{SS.features = TRUE}, secondary structure
#' features will be used.
#'
#' @param format String. Define the format of the \code{Sequences}. Can be
#' \code{"DNA"} or \code{"SS"}. \code{"DNA"} for DNA sequences and \code{"SS"}
#' for secondary structure sequences.
#'
#' @param frequencies.file String or a list obtained from function
#' \code{\link{make_frequencies}}. Input species name \code{"human"}, \code{"mouse"}
#' or \code{"wheat"} to use pre-build frequencies files. Or assign a users' own
#' frequencies file (See function \code{\link{make_frequencies}}).
#'
#' @param svm.model String or a svm model obtained from function \code{\link{build_model}}
#' or \code{\link{svm_tune}}. Input species name \code{"human"}, \code{"mouse"}
#' or \code{"wheat"} to use pre-build models. Or assign a users' own model (See
#' function \code{\link{build_model}}).
#'
#' @param parallel.cores Integer. The number of cores for parallel computation.
#' By default the number of cores is \code{2}. Users can set as \code{-1} to run
#' this function with all cores.
#'
#' @return Returns a data.frame. Including the results of prediction (\code{Pred});
#' coding potential (\code{Coding.Potential}) and the features. For the details
#' of the features, please refer to function \code{\link{extract_features}}.
#'
#' @author HAN Siyu
#'
#' @details Considering that it is time consuming to obtain secondary structure
#' sequences, users can input nucleotide sequences and predict these sequences
#' without secondary structure features (Set \code{SS.features} as \code{FALSE}).
#'
#' Please note that:
#'
#' \code{SS.features} can improve the performance when the species of unevaluated
#' sequences is identical to the species of the sequences that used to build the
#' model.
#'
#' However, if users are trying to predict sequences with the model trained on
#' other species, \code{SS.features} may lead to low accuracy.
#'
#' For the details of \code{frequencies.file}, please refer to function
#' \code{\link{make_frequencies}}.
#'
#' For the details of the features, please refer to function
#' \code{\link{extract_features}}.
#'
#' @section References:
#' Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li.
#' LncFinder: an integrated platform for long non-coding RNA identification utilizing
#' sequence intrinsic composition, structural information, and physicochemical property.
#' \emph{Briefings in Bioinformatics}, 2019, 20(6):2009-2027.
#'
#' @importFrom seqinr s2c
#' @importFrom seqinr count
#' @importFrom seqinr getSequence
#' @importFrom parallel detectCores
#' @importFrom parallel makeCluster
#' @importFrom parallel clusterExport
#' @importFrom parallel parSapply
#' @importFrom parallel stopCluster
#' @seealso \code{\link{build_model}}, \code{\link{make_frequencies}},
#' \code{\link{extract_features}}, \code{\link{run_RNAfold}}, \code{\link{read_SS}}.
#' @examples
#' \dontrun{
#' data(demo_DNA.seq)
#' Seqs <- demo_DNA.seq
#'
#' ### Input one sequence:
#' OneSeq <- Seqs[1]
#' result_1 <- lnc_finder(OneSeq, SS.features = FALSE, format = "DNA",
#' frequencies.file = "human", svm.model = "human",
#' parallel.cores = 2)
#'
#' ### Or several sequences:
#' data(demo_SS.seq)
#' Seqs <- demo_SS.seq
#' result_2 <- lnc_finder(Seqs, SS.features = TRUE, format = "SS",
#' frequencies.file = "mouse", svm.model = "mouse",
#' parallel.cores = 2)
#'
#' ### A complete work flow:
#' ### Calculate second structure on Windows OS,
#' RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"'
#' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2)
#'
#' ### Predict the sequences with secondary structure features,
#' result_2 <- lnc_finder(SS.seq, SS.features = TRUE, format = "SS",
#' frequencies.file = "mouse", svm.model = "mouse",
#' parallel.cores = 2)
#'
#' ### Predict sequences with your own model by assigning a new svm.model and
#' ### frequencies.file to parameters "svm.model" and "frequencies.file"
#' }
#' @export
lnc_finder <- function(Sequences, SS.features = FALSE, format = "DNA", frequencies.file = "human",
svm.model = "human", parallel.cores = 2) {
if(is.character(svm.model)) { # class(svm.model)[1] == "character"
if(SS.features) {
if(svm.model == "human") {
svm.mod <- human.mod
} else if(svm.model == "mouse") {
svm.mod <- mouse.mod
} else if(svm.model == "wheat") {
svm.mod <- wheat.mod
} else stop("Wrong svm.model name.")
} else {
if(svm.model == "human") {
svm.mod <- human.mod.no_ss
} else if(svm.model == "mouse") {
svm.mod <- mouse.mod.no_ss
} else if(svm.model == "wheat") {
svm.mod <- wheat.mod.no_ss
} else stop("Wrong svm.model name.")
}
} else svm.mod <- svm.model
parallel.cores <- ifelse(parallel.cores == -1, parallel::detectCores(), parallel.cores)
seq.data <- extract_features(Sequences, SS.features = SS.features, format = format,
frequencies.file = frequencies.file, parallel.cores = parallel.cores)
message("+ Predicting...", "\n")
pred.res <- stats::predict(svm.mod, seq.data, probability = TRUE)
results <- data.frame(Pred = pred.res)
prob.res <- data.frame(Result = results, Coding.Potential = (attr(pred.res, "probabilities")[,2]))
output <- cbind(prob.res, seq.data)
message("+ Process completed.", "\n")
output
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.