Nothing
create_isolated_test_db()
test_that("grevcomp handles basic DNA sequences correctly", {
# Test single sequence
expect_equal(grevcomp("ACTG"), "CAGT")
# Test palindromic sequence
expect_equal(grevcomp("GCGC"), "GCGC")
# Test multiple sequences
expect_equal(
grevcomp(c("ACTG", "GCGC", "AAAA")),
c("CAGT", "GCGC", "TTTT")
)
})
test_that("grevcomp preserves case", {
# Test mixed case
expect_equal(grevcomp("AcTg"), "cAgT")
expect_equal(grevcomp("gCGc"), "gCGc")
# Test all lowercase
expect_equal(grevcomp("actg"), "cagt")
# Test all uppercase
expect_equal(grevcomp("ACTG"), "CAGT")
})
test_that("grevcomp handles empty and special cases", {
# Test empty string
expect_equal(grevcomp(""), "")
# Test empty vector
expect_equal(grevcomp(character(0)), character(0))
# Test vector with empty strings
expect_equal(
grevcomp(c("ACTG", "", "GCTA")),
c("CAGT", "", "TAGC")
)
# Test NA values
expect_equal(grevcomp(NA_character_), NA_character_)
expect_equal(grevcomp(c("ACTG", NA, "GCTA")), c("CAGT", NA, "TAGC"))
})
test_that("grevcomp validates input", {
# Test non-character input
expect_error(grevcomp(123))
expect_error(grevcomp(TRUE))
expect_error(grevcomp(as.factor("ACTG")))
})
test_that("grevcomp handles long sequences", {
# Test long sequence
long_seq <- paste(rep("ACTG", 1000), collapse = "")
expected <- paste(rep("CAGT", 1000), collapse = "")
expect_equal(grevcomp(long_seq), expected)
# Test vector of long sequences
expect_equal(
grevcomp(c(long_seq, "AAAA", long_seq)),
c(expected, "TTTT", expected)
)
})
test_that("grevcomp is reversible", {
# Test that applying grevcomp twice returns original sequence
seqs <- c(
"ACTG",
"GCTA",
"AAAAAA",
"GCGCGC",
paste(rep("ACTG", 100), collapse = "")
)
for (seq in seqs) {
expect_equal(grevcomp(grevcomp(seq)), seq)
}
})
test_that("grevcomp performance on large input", {
# Create large input
n_seqs <- 10000
seq_length <- 1000
large_input <- replicate(n_seqs, {
paste(sample(c("A", "C", "G", "T"), seq_length, replace = TRUE), collapse = "")
})
# Test that it completes in reasonable time
expect_true(
system.time(grevcomp(large_input))[["elapsed"]] <= 10,
"grevcomp took too long for large input"
)
})
test_that("grevcomp handles various vector cases", {
# Test vector with repeated sequences
expect_equal(
grevcomp(c("ACTG", "ACTG", "ACTG")),
c("CAGT", "CAGT", "CAGT")
)
# Test vector with all empty strings
expect_equal(
grevcomp(c("", "", "")),
c("", "", "")
)
# Test vector with mixed lengths
expect_equal(
grevcomp(c("A", "ACTG", "AAAAAA")),
c("T", "CAGT", "TTTTTT")
)
# Test vector with mixed case and empty strings
expect_equal(
grevcomp(c("AcTg", "", "GcTa", "actg", "ACTG")),
c("cAgT", "", "tAgC", "cagt", "CAGT")
)
})
test_that("grevcomp handles NA patterns in vectors", {
# Test vector starting with NA
expect_equal(
grevcomp(c(NA, "ACTG", "GCTA")),
c(NA, "CAGT", "TAGC")
)
# Test vector ending with NA
expect_equal(
grevcomp(c("ACTG", "GCTA", NA)),
c("CAGT", "TAGC", NA)
)
# Test vector with multiple NAs
expect_equal(
grevcomp(c("ACTG", NA, "GCTA", NA, "AAAA")),
c("CAGT", NA, "TAGC", NA, "TTTT")
)
# Test vector with all NAs
expect_equal(
grevcomp(c(NA_character_, NA_character_, NA_character_)),
c(NA_character_, NA_character_, NA_character_)
)
# Test vector with NAs and empty strings
expect_equal(
grevcomp(c(NA, "", "ACTG", NA, "")),
c(NA, "", "CAGT", NA, "")
)
})
test_that("grevcomp maintains vector attributes", {
# Test named vector
input <- c(seq1 = "ACTG", seq2 = "GCTA")
expected <- c(seq1 = "CAGT", seq2 = "TAGC")
expect_equal(grevcomp(input), expected)
# Test vector with names and NAs
input <- c(seq1 = "ACTG", missing = NA, seq2 = "GCTA")
expected <- c(seq1 = "CAGT", missing = NA, seq2 = "TAGC")
expect_equal(grevcomp(input), expected)
})
test_that("grevcomp handles vectors of varied content", {
# Mixed case, empty strings, and NAs
input <- c(
"AcTg",
"",
NA,
"GCTA",
"actg",
NA,
"",
"GcTa"
)
expected <- c(
"cAgT",
"",
NA,
"TAGC",
"cagt",
NA,
"",
"tAgC"
)
expect_equal(grevcomp(input), expected)
# Test with very long vector
long_vec <- rep(c("ACTG", NA, "", "GcTa"), 1000)
expected_long <- rep(c("CAGT", NA, "", "tAgC"), 1000)
expect_equal(grevcomp(long_vec), expected_long)
})
test_that("grevcomp preserves vector length", {
# Test vectors of different lengths
lengths <- c(0, 1, 5, 10, 100, 1000)
for (len in lengths) {
input <- rep(c("ACTG", NA, "GCTA"), length.out = len)
result <- grevcomp(input)
expect_equal(length(result), len)
}
})
# ============================================================================
# Tests for gseq.revcomp() - Alias for grevcomp
# ============================================================================
test_that("gseq.revcomp is an alias for grevcomp", {
# Test that gseq.revcomp produces the same results as grevcomp
seqs <- c("ACTG", "GCGC", "AAAA", NA, "")
expect_equal(gseq.revcomp(seqs), grevcomp(seqs))
})
test_that("gseq.revcomp handles various inputs", {
# Test single sequence
expect_equal(gseq.revcomp("ACTG"), "CAGT")
# Test multiple sequences
expect_equal(
gseq.revcomp(c("ACTG", "GCGC")),
c("CAGT", "GCGC")
)
# Test with NA
expect_equal(
gseq.revcomp(c("ACTG", NA, "GCTA")),
c("CAGT", NA, "TAGC")
)
# Test case preservation
expect_equal(gseq.revcomp("AcTg"), "cAgT")
})
# ============================================================================
# Tests for gseq.rev() - Reverse without complement
# ============================================================================
test_that("gseq.rev handles basic DNA sequences correctly", {
# Test single sequence
expect_equal(gseq.rev("ACTG"), "GTCA")
# Test multiple sequences
expect_equal(
gseq.rev(c("ACTG", "GCGC", "AAAA")),
c("GTCA", "CGCG", "AAAA")
)
})
test_that("gseq.rev preserves case", {
# Test mixed case
expect_equal(gseq.rev("AcTg"), "gTcA")
# Test all lowercase
expect_equal(gseq.rev("actg"), "gtca")
# Test all uppercase
expect_equal(gseq.rev("ACTG"), "GTCA")
})
test_that("gseq.rev handles empty and special cases", {
# Test empty string
expect_equal(gseq.rev(""), "")
# Test empty vector
expect_equal(gseq.rev(character(0)), character(0))
# Test vector with empty strings
expect_equal(
gseq.rev(c("ACTG", "", "GCTA")),
c("GTCA", "", "ATCG")
)
# Test NA values
expect_equal(gseq.rev(NA_character_), NA_character_)
expect_equal(gseq.rev(c("ACTG", NA, "GCTA")), c("GTCA", NA, "ATCG"))
})
test_that("gseq.rev validates input", {
# Test non-character input
expect_error(gseq.rev(123))
expect_error(gseq.rev(TRUE))
})
test_that("gseq.rev is reversible", {
# Test that applying gseq.rev twice returns original sequence
seqs <- c(
"ACTG",
"GCTA",
"AAAAAA",
"GCGCGC",
paste(rep("ACTG", 100), collapse = "")
)
for (seq in seqs) {
expect_equal(gseq.rev(gseq.rev(seq)), seq)
}
})
test_that("gseq.rev maintains vector attributes", {
# Test named vector
input <- c(seq1 = "ACTG", seq2 = "GCTA")
expected <- c(seq1 = "GTCA", seq2 = "ATCG")
expect_equal(gseq.rev(input), expected)
# Test vector with names and NAs
input <- c(seq1 = "ACTG", missing = NA, seq2 = "GCTA")
expected <- c(seq1 = "GTCA", missing = NA, seq2 = "ATCG")
expect_equal(gseq.rev(input), expected)
})
# ============================================================================
# Tests for gseq.comp() - Complement without reverse
# ============================================================================
test_that("gseq.comp handles basic DNA sequences correctly", {
# Test single sequence
expect_equal(gseq.comp("ACTG"), "TGAC")
# Test multiple sequences
expect_equal(
gseq.comp(c("ACTG", "GCGC", "AAAA")),
c("TGAC", "CGCG", "TTTT")
)
})
test_that("gseq.comp preserves case", {
# Test mixed case
expect_equal(gseq.comp("AcTg"), "TgAc")
# Test all lowercase
expect_equal(gseq.comp("actg"), "tgac")
# Test all uppercase
expect_equal(gseq.comp("ACTG"), "TGAC")
})
test_that("gseq.comp handles empty and special cases", {
# Test empty string
expect_equal(gseq.comp(""), "")
# Test empty vector
expect_equal(gseq.comp(character(0)), character(0))
# Test vector with empty strings
expect_equal(
gseq.comp(c("ACTG", "", "GCTA")),
c("TGAC", "", "CGAT")
)
# Test NA values
expect_equal(gseq.comp(NA_character_), NA_character_)
expect_equal(gseq.comp(c("ACTG", NA, "GCTA")), c("TGAC", NA, "CGAT"))
})
test_that("gseq.comp validates input", {
# Test non-character input
expect_error(gseq.comp(123))
expect_error(gseq.comp(TRUE))
})
test_that("gseq.comp is reversible", {
# Test that applying gseq.comp twice returns original sequence
seqs <- c(
"ACTG",
"GCTA",
"AAAAAA",
"GCGCGC",
paste(rep("ACTG", 100), collapse = "")
)
for (seq in seqs) {
expect_equal(gseq.comp(gseq.comp(seq)), seq)
}
})
test_that("gseq.comp maintains vector attributes", {
# Test named vector
input <- c(seq1 = "ACTG", seq2 = "GCTA")
expected <- c(seq1 = "TGAC", seq2 = "CGAT")
expect_equal(gseq.comp(input), expected)
# Test vector with names and NAs
input <- c(seq1 = "ACTG", missing = NA, seq2 = "GCTA")
expected <- c(seq1 = "TGAC", missing = NA, seq2 = "CGAT")
expect_equal(gseq.comp(input), expected)
})
# ============================================================================
# Tests for relationship between gseq.rev, gseq.comp, and gseq.revcomp
# ============================================================================
test_that("gseq.revcomp equals gseq.comp then gseq.rev", {
seqs <- c("ACTG", "GCTA", "AAAATTTT", "CGCGCGCG")
for (seq in seqs) {
expect_equal(gseq.revcomp(seq), gseq.rev(gseq.comp(seq)))
}
})
test_that("gseq.revcomp equals gseq.rev then gseq.comp", {
seqs <- c("ACTG", "GCTA", "AAAATTTT", "CGCGCGCG")
for (seq in seqs) {
expect_equal(gseq.revcomp(seq), gseq.comp(gseq.rev(seq)))
}
})
test_that("gseq functions handle mixed operations", {
seq <- "ACTG"
# rev(comp(seq)) should equal comp(rev(seq))
expect_equal(gseq.rev(gseq.comp(seq)), gseq.comp(gseq.rev(seq)))
# This should also equal revcomp(seq)
expect_equal(gseq.rev(gseq.comp(seq)), gseq.revcomp(seq))
})
# ============================================================================
# Tests for gseq.pwm() - PWM scoring on strings with ROI
# ============================================================================
test_that("gseq.pwm validates inputs correctly", {
# Create a simple PSSM for testing (using probabilities, not log-odds)
# This matrix represents a motif that strongly prefers "AC"
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seqs <- "ACGTACGT"
# Should work with valid inputs
expect_no_error(gseq.pwm(seqs, pssm, mode = "lse", prior = 0))
# Bad PSSM: not a matrix
expect_error(gseq.pwm(seqs, c(1, 2, 3, 4), mode = "lse", prior = 0), "matrix")
# Bad PSSM: missing required column names
bad_pssm <- matrix(1:6, nrow = 2)
expect_error(gseq.pwm(seqs, bad_pssm, mode = "lse", prior = 0), "A, C, G, T")
# Bad PSSM: wrong column names
bad_pssm <- pssm
colnames(bad_pssm) <- c("X", "Y", "Z", "W")
expect_error(gseq.pwm(seqs, bad_pssm, mode = "lse", prior = 0), "A, C, G, T")
# Bad strand
expect_error(gseq.pwm(seqs, pssm, mode = "lse", strand = 5, prior = 0), "strand must be")
# Bad extend
expect_error(gseq.pwm(seqs, pssm, mode = "lse", extend = -5, prior = 0), "extend must be")
})
test_that("gseq.pwm accepts data frame PSSM inputs", {
pssm <- matrix(c(
0.4, 0.3, 0.2, 0.1,
0.1, 0.2, 0.3, 0.4
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seqs <- c("ACGT", "TTTT")
matrix_modes <- list(
lse = gseq.pwm(seqs, pssm, mode = "lse", prior = 0),
max = gseq.pwm(seqs, pssm, mode = "max", prior = 0),
count = gseq.pwm(seqs, pssm, mode = "count", prior = 0, score.thresh = -10),
pos = gseq.pwm(seqs, pssm, mode = "pos", prior = 0),
pos_strand = gseq.pwm(seqs, pssm, mode = "pos", prior = 0, return_strand = TRUE)
)
# Neutral character handling
neutral_seq <- "ANNT"
default_neutral <- gseq.pwm(neutral_seq, pssm, mode = "max", prior = 0)
no_neutral <- gseq.pwm(neutral_seq, pssm, mode = "max", prior = 0, neutral_chars = character())
expect_true(default_neutral > no_neutral)
expect_equal(
default_neutral,
gseq.pwm(neutral_seq, pssm, mode = "max", prior = 0, neutral_chars = c("N", "n", "*"))
)
df_modes <- list(
lse = gseq.pwm(seqs, as.data.frame(pssm), mode = "lse", prior = 0),
max = gseq.pwm(seqs, as.data.frame(pssm), mode = "max", prior = 0),
count = gseq.pwm(seqs, as.data.frame(pssm), mode = "count", prior = 0, score.thresh = -10),
pos = gseq.pwm(seqs, as.data.frame(pssm), mode = "pos", prior = 0),
pos_strand = gseq.pwm(seqs, as.data.frame(pssm), mode = "pos", prior = 0, return_strand = TRUE)
)
expect_equal(df_modes$lse, matrix_modes$lse)
expect_identical(df_modes$max, matrix_modes$max)
expect_identical(df_modes$count, matrix_modes$count)
expect_identical(df_modes$pos, matrix_modes$pos)
expect_identical(df_modes$pos_strand, matrix_modes$pos_strand)
})
test_that("gseq.pwm handles ROI bounds correctly", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with AC at positions 5-6
seq <- "GGGGACGGGG"
# 123456789..
# ROI covering AC (5-6) should find it
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 5, end_pos = 6, extend = FALSE)
expect_equal(result, 1)
# ROI before AC (1-4) should not find it
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 1, end_pos = 4, extend = FALSE)
expect_equal(result, 0)
# ROI after AC (7-10) should not find it
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 7, end_pos = 10, extend = FALSE)
expect_equal(result, 0)
})
test_that("gseq.pwm neutral_chars_policy options alter neutral scoring", {
pssm <- matrix(
c(
0.8, 0.1, 0.05, 0.05,
0.1, 0.2, 0.3, 0.4
),
ncol = 4, byrow = TRUE
)
colnames(pssm) <- c("A", "C", "G", "T")
manual_score <- function(seq, policy) {
chars <- strsplit(seq, "")[[1]]
log_pssm <- log(pssm)
neutral_chars <- "N"
val <- 0
for (i in seq_along(chars)) {
base <- chars[[i]]
row <- log_pssm[i, ]
if (base %in% colnames(pssm)) {
val <- val + row[[base]]
} else if (base %in% neutral_chars) {
if (policy == "average") {
val <- val + mean(row)
} else if (policy == "log_quarter") {
val <- val + log(0.25)
} else if (policy == "na") {
return(NA_real_)
}
} else {
return(-Inf)
}
}
val
}
seqs <- c("AN", "AT")
res_avg <- gseq.pwm(
seqs, pssm,
mode = "max", bidirect = FALSE, strand = 1L,
skip_gaps = FALSE, neutral_chars = "N", prior = 0,
neutral_chars_policy = "average"
)
res_lq <- gseq.pwm(
seqs, pssm,
mode = "max", bidirect = FALSE, strand = 1L,
skip_gaps = FALSE, neutral_chars = "N", prior = 0,
neutral_chars_policy = "log_quarter"
)
res_na <- gseq.pwm(
seqs, pssm,
mode = "max", bidirect = FALSE, strand = 1L,
skip_gaps = FALSE, neutral_chars = "N", prior = 0,
neutral_chars_policy = "na"
)
expect_equal(res_avg[1], manual_score("AN", "average"), tolerance = 1e-6)
expect_equal(res_avg[2], manual_score("AT", "average"), tolerance = 1e-6)
expect_equal(res_lq[1], manual_score("AN", "log_quarter"), tolerance = 1e-6)
expect_equal(res_lq[2], manual_score("AT", "average"), tolerance = 1e-6)
expect_true(is.na(res_na[1]))
expect_equal(res_na[2], manual_score("AT", "average"), tolerance = 1e-6)
})
test_that("gseq.pwm extend parameter works correctly", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with AC at position 5-6
seq <- "GGGGACGGGG"
# 123456789..
# ROI at 6-6 (just "C"), no extend: should not find AC
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 6, end_pos = 6, extend = FALSE)
expect_equal(result, 0)
# ROI at 6-6, extend=TRUE (w-1=1): should find AC starting at position 5
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 6, end_pos = 6, extend = TRUE)
expect_equal(result, 1)
# ROI at 6-6, extend=1 (explicit): same as extend=TRUE
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 6, end_pos = 6, extend = 1)
expect_equal(result, 1)
# ROI at 7-7, extend=2: should find AC (start_min = 7-2 = 5)
result <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 7, end_pos = 7, extend = 2)
expect_equal(result, 1)
})
test_that("gseq.pwm mode='pos' reports correct 1-based positions", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with AC at positions 3-4 and 7-8
seq <- "GGACGGACGG"
# 123456789..
# Should find first AC at position 3
result <- gseq.pwm(seq, pssm, mode = "pos", prior = 0, start_pos = 1, end_pos = 10, extend = FALSE)
expect_equal(result, 3)
# Limit ROI to find second AC at position 7
result <- gseq.pwm(seq, pssm, mode = "pos", prior = 0, start_pos = 5, end_pos = 10, extend = FALSE)
expect_equal(result, 7)
})
test_that("gseq.pwm mode='pos' with return_strand works", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with AC (forward)
seq <- "GGACGG"
result <- gseq.pwm(seq, pssm,
mode = "pos", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 6, extend = FALSE, return_strand = TRUE,
skip_gaps = FALSE, prior = 0
)
expect_true(is.data.frame(result))
expect_equal(names(result), c("pos", "strand"))
expect_equal(result$pos, 3)
expect_equal(result$strand, 1)
})
test_that("gseq.pwm tie-breaking: prefer leftmost position", {
# Create uniform PSSM (all probabilities equal)
pssm <- matrix(1.0, nrow = 2, ncol = 4) # Normalizes to 0.25 each
colnames(pssm) <- c("A", "C", "G", "T")
seq <- "ACGTACGT"
# All positions score equally, should return leftmost (position 1)
result <- gseq.pwm(seq, pssm, mode = "pos", prior = 0, start_pos = 1, end_pos = 8, extend = FALSE)
expect_equal(result, 1)
})
test_that("gseq.pwm handles edge case: sequence too short", {
# Create PSSM length 5 (using uniform probabilities)
pssm <- matrix(1.0, nrow = 5, ncol = 4)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence length 3 (< motif width)
seq <- "ACG"
result_total <- gseq.pwm(seq, pssm, mode = "lse", prior = 0)
expect_true(is.na(result_total))
result_max <- gseq.pwm(seq, pssm, mode = "max", prior = 0)
expect_true(is.na(result_max))
result_count <- gseq.pwm(seq, pssm, mode = "count", prior = 0)
expect_equal(result_count, 0)
result_pos <- gseq.pwm(seq, pssm, mode = "pos", prior = 0)
expect_true(is.na(result_pos))
})
test_that("gseq.pwm handles edge case: empty ROI", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seq <- "ACGTACGT"
# start_pos > end_pos: invalid ROI
result_count <- gseq.pwm(seq, pssm, mode = "count", prior = 0, start_pos = 5, end_pos = 3)
expect_equal(result_count, 0)
result_total <- gseq.pwm(seq, pssm, mode = "lse", prior = 0, start_pos = 5, end_pos = 3)
expect_true(is.na(result_total))
})
test_that("gseq.pwm mode='lse' aggregates scores using log-sum-exp", {
# Create PSSM for "A" (single base, using probabilities)
pssm <- matrix(c(1.0, 1e-10, 1e-10, 1e-10), nrow = 1, ncol = 4)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with 3 A's at positions 1, 3, 5
seq <- "AGAGA"
# Each A scores log(~1.0), total should be sum of log-probabilities
# With probabilities (1.0, 1e-10, 1e-10, 1e-10), after normalization A gets ~0.9999...
# log(0.9999...) is close to 0, but with bidirect mode and log-sum-exp it may vary
result_full <- gseq.pwm(seq, pssm, mode = "lse", prior = 0, start_pos = 1, end_pos = 5, extend = FALSE)
expect_true(is.finite(result_full)) # Should be a finite number
# Only 2 A's in ROI 1-3
result_partial <- gseq.pwm(seq, pssm, mode = "lse", prior = 0, start_pos = 1, end_pos = 3, extend = FALSE)
expect_true(is.finite(result_partial)) # Should be a finite number
# Note: With log-sum-exp in bidirect mode, the relationship between partial and full
# may not be monotonic, so we just check that both are finite
})
test_that("gseq.pwm mode='max' finds maximum score", {
# Create PSSM that strongly prefers A (using probabilities)
pssm <- matrix(c(1.0, 1e-10, 1e-10, 1e-10), nrow = 1, ncol = 4)
colnames(pssm) <- c("A", "C", "G", "T")
seq <- "CGACG"
# Should find A at position 3 with score close to 0 (log of ~1.0)
result <- gseq.pwm(seq, pssm, mode = "max", prior = 0, start_pos = 1, end_pos = 5, extend = FALSE)
expect_true(result > -1 && result < 1) # Should be close to 0
})
test_that("gseq.pwm mode='count' with threshold works", {
# Create PSSM with different probabilities for A and C (using probabilities)
# A gets higher probability than C
pssm <- matrix(c(
100, 10, 1e-10, 1e-10 # A: ~90%, C: ~9%, G/T: ~0%
), nrow = 1, ncol = 4)
colnames(pssm) <- c("A", "C", "G", "T")
seq <- "AACCCG"
# Count positions scoring >= -1.0 (only A's, 2 of them - forward strand only)
# A will score log(~0.9) ≈ -0.1, C will score log(~0.09) ≈ -2.4
result <- gseq.pwm(seq, pssm,
mode = "count", score.thresh = -1.0,
bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 6, extend = FALSE,
skip_gaps = FALSE, prior = 0
)
expect_equal(result, 2)
# Count positions scoring >= -3.0 (A's and C's, 5 total - forward strand only)
result <- gseq.pwm(seq, pssm,
mode = "count", score.thresh = -3.0,
bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 6, extend = FALSE,
skip_gaps = FALSE, prior = 0
)
expect_equal(result, 5)
})
test_that("gseq.pwm vectorization works", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seqs <- c("GGACGG", "GGGGGG", "ACACAC")
result <- gseq.pwm(seqs, pssm, mode = "count", prior = 0, bidirect = FALSE, strand = 1, start_pos = 1, end_pos = 6, extend = FALSE)
expect_equal(length(result), 3)
expect_equal(result[1], 1) # 1 AC (forward strand only)
expect_equal(result[2], 0) # 0 AC
expect_equal(result[3], 3) # 3 AC (forward strand only)
})
test_that("gseq.pwm handles vectorized start_pos and end_pos", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # Position 1: strongly prefers A
1e-10, 1.0, 1e-10, 1e-10 # Position 2: strongly prefers C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seqs <- c("ACACAC", "ACACAC")
# Different ROIs per sequence (forward strand only)
result <- gseq.pwm(seqs, pssm,
mode = "count",
bidirect = FALSE, strand = 1,
start_pos = c(1, 3), end_pos = c(4, 6), extend = FALSE,
skip_gaps = FALSE, prior = 0
)
expect_equal(result[1], 2) # AC at 1-2, 3-4 (forward strand only)
expect_equal(result[2], 2) # AC at 3-4, 5-6 (forward strand only)
})
# ============================================================================
# Tests for gseq.kmer() - k-mer scoring on strings with ROI
# ============================================================================
test_that("gseq.kmer validates inputs correctly", {
seqs <- "ACGTACGT"
# Should work with valid inputs
expect_no_error(gseq.kmer(seqs, "AC", mode = "count"))
# Bad kmer: not a single string
expect_error(gseq.kmer(seqs, c("AC", "GT"), mode = "count"), "single character")
# Bad kmer: contains invalid characters
expect_error(gseq.kmer(seqs, "ACN", mode = "count"), "only A, C, G, T")
# Bad strand
expect_error(gseq.kmer(seqs, "AC", mode = "count", strand = 5), "strand must be")
# Bad extend
expect_error(gseq.kmer(seqs, "AC", mode = "count", extend = -5), "extend must be")
})
test_that("gseq.kmer mode='count' counts exact matches", {
seq <- "CGCGCGCG"
# Count CG (4 occurrences)
result <- gseq.kmer(seq, "CG", mode = "count", start_pos = 1, end_pos = 8, extend = FALSE)
expect_equal(result, 4)
# Count GC (3 occurrences)
result <- gseq.kmer(seq, "GC", mode = "count", start_pos = 1, end_pos = 8, extend = FALSE)
expect_equal(result, 3)
# Count AA (0 occurrences)
result <- gseq.kmer(seq, "AA", mode = "count", start_pos = 1, end_pos = 8, extend = FALSE)
expect_equal(result, 0)
})
test_that("gseq.kmer mode='frac' computes correct fractions", {
seq <- "AAACCCGGG" # length 9
# 123456789
# Count A's: 3 out of 9 possible positions (forward strand only)
result <- gseq.kmer(seq, "A", mode = "frac", strand = 1, start_pos = 1, end_pos = 9, extend = FALSE)
expect_equal(result, 3 / 9)
# Count C's: 3 out of 9 possible positions (forward strand only)
result <- gseq.kmer(seq, "C", mode = "frac", strand = 1, start_pos = 1, end_pos = 9, extend = FALSE)
expect_equal(result, 3 / 9)
# Count AA's: 2 out of 8 possible positions (at pos 1-2 and 2-3, forward strand only)
# Sequence "AAACCCGGG" has "AA" at positions 1-2 and 2-3
result <- gseq.kmer(seq, "AA", mode = "frac", strand = 1, start_pos = 1, end_pos = 9, extend = FALSE)
expect_equal(result, 2 / 8) # 2 matches out of 8 possible start positions
})
test_that("gseq.kmer handles ROI bounds correctly", {
seq <- "GGGGACGGGG"
# 123456789..
# ROI covering AC (5-6)
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 5, end_pos = 6, extend = FALSE)
expect_equal(result, 1)
# ROI before AC (1-4)
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 1, end_pos = 4, extend = FALSE)
expect_equal(result, 0)
# ROI after AC (7-10)
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 7, end_pos = 10, extend = FALSE)
expect_equal(result, 0)
})
test_that("gseq.kmer extend parameter works correctly", {
seq <- "GGGGACGGGG"
# 123456789..
# ROI at 6-6 (just "C"), no extend: should not find AC
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 6, end_pos = 6, extend = FALSE)
expect_equal(result, 0)
# ROI at 6-6, extend=TRUE (k-1=1): should find AC starting at position 5
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 6, end_pos = 6, extend = TRUE)
expect_equal(result, 1)
# ROI at 6-6, extend=1 (explicit): same as extend=TRUE
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 6, end_pos = 6, extend = 1)
expect_equal(result, 1)
})
test_that("gseq.kmer strand parameter works", {
seq <- "ACGTACGT"
# Forward strand only: count AC (2 occurrences)
result <- gseq.kmer(seq, "AC", mode = "count", strand = 1, start_pos = 1, end_pos = 8)
expect_equal(result, 2)
# Reverse strand only: count GT (reverse complement of AC, 2 occurrences)
result <- gseq.kmer(seq, "AC", mode = "count", strand = -1, start_pos = 1, end_pos = 8)
expect_equal(result, 2)
# Both strands: count positions where AC or GT appears
# AC at 1-2, 5-6; GT at 3-4, 7-8 -> 4 matches
result <- gseq.kmer(seq, "AC", mode = "count", strand = 0, start_pos = 1, end_pos = 8)
expect_equal(result, 4)
})
test_that("gseq.kmer handles edge case: sequence too short", {
seq <- "AC"
# k-mer length 5 > sequence length 2
result <- gseq.kmer(seq, "ACGTA", mode = "count")
expect_equal(result, 0)
result <- gseq.kmer(seq, "ACGTA", mode = "frac")
expect_equal(result, 0)
})
test_that("gseq.kmer handles edge case: empty ROI", {
seq <- "ACGTACGT"
# start_pos > end_pos: invalid ROI
result <- gseq.kmer(seq, "AC", mode = "count", start_pos = 5, end_pos = 3)
expect_equal(result, 0)
result <- gseq.kmer(seq, "AC", mode = "frac", start_pos = 5, end_pos = 3)
expect_equal(result, 0)
})
test_that("gseq.kmer vectorization works", {
seqs <- c("ACACAC", "GGGGGG", "CGCGCG")
result <- gseq.kmer(seqs, "AC", mode = "count", start_pos = 1, end_pos = 6, extend = FALSE)
expect_equal(length(result), 3)
expect_equal(result[1], 3) # 3 AC
expect_equal(result[2], 0) # 0 AC
expect_equal(result[3], 0) # 0 AC
})
test_that("gseq.kmer handles vectorized start_pos and end_pos", {
seqs <- c("ACACAC", "ACACAC")
# Different ROIs per sequence
result <- gseq.kmer(seqs, "AC",
mode = "count",
start_pos = c(1, 3), end_pos = c(4, 6), extend = FALSE
)
expect_equal(result[1], 2) # AC at 1-2, 3-4
expect_equal(result[2], 2) # AC at 3-4, 5-6
})
test_that("gseq.kmer frac denominator is computed correctly", {
seq <- "ACGTACGT" # length 8
# k=2: 7 possible positions (8 - 2 + 1)
# Count AC: 2 occurrences (forward strand only)
result <- gseq.kmer(seq, "AC", mode = "frac", strand = 1, start_pos = 1, end_pos = 8, extend = FALSE)
expect_equal(result, 2 / 7)
# With ROI 1-4: 3 possible positions (4 - 2 + 1)
# Count AC: 1 occurrence (forward strand only)
result <- gseq.kmer(seq, "AC", mode = "frac", strand = 1, start_pos = 1, end_pos = 4, extend = FALSE)
expect_equal(result, 1 / 3)
})
# ============================================================================
# Comparison tests: gseq.pwm vs gextract with PWM virtual tracks
# ============================================================================
test_that("gseq.pwm matches gextract PWM vtrack: mode='lse', no extend", {
remove_all_vtracks()
pssm <- create_test_pssm() # AC motif with probabilities
# Test on a specific interval
test_interval <- gintervals(1, 200, 240)
seq <- toupper(gseq.extract(test_interval))
# Create virtual track
gvtrack.create("pwm_total", NULL,
func = "pwm",
pssm = pssm, bidirect = FALSE, extend = FALSE, prior = 0.01
)
# Extract using gextract
vtrack_result <- gextract("pwm_total", test_interval, iterator = test_interval)
# Score using gseq.pwm (need to add prior to match virtual track)
pssm_with_prior <- pssm + 0.01
for (i in 1:nrow(pssm_with_prior)) {
pssm_with_prior[i, ] <- pssm_with_prior[i, ] / sum(pssm_with_prior[i, ])
}
gseq_result <- gseq.pwm(seq, pssm_with_prior,
mode = "lse", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE,
skip_gaps = FALSE, prior = 0
)
expect_equal(gseq_result, vtrack_result$pwm_total, tolerance = 1e-6)
})
test_that("gseq.pwm matches gextract PWM vtrack: mode='lse', with extend", {
remove_all_vtracks()
pssm <- create_test_pssm() # AC motif
test_interval <- gintervals(1, 200, 240)
# For extend=TRUE, need to extract extended sequence
extended_interval <- test_interval
extended_interval$end <- extended_interval$end + nrow(pssm) - 1
seq_ext <- toupper(gseq.extract(extended_interval))
# Create virtual track
gvtrack.create("pwm_ext", NULL,
func = "pwm",
pssm = pssm, bidirect = FALSE, extend = TRUE, prior = 0.01
)
# Extract using gextract
vtrack_result <- gextract("pwm_ext", test_interval, iterator = test_interval)
# Score using gseq.pwm
pssm_with_prior <- pssm + 0.01
for (i in 1:nrow(pssm_with_prior)) {
pssm_with_prior[i, ] <- pssm_with_prior[i, ] / sum(pssm_with_prior[i, ])
}
gseq_result <- gseq.pwm(seq_ext, pssm_with_prior,
mode = "lse", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = nchar(seq_ext), extend = TRUE,
skip_gaps = FALSE, prior = 0
)
expect_equal(gseq_result, vtrack_result$pwm_ext, tolerance = 1e-6)
})
test_that("gseq.pwm matches gextract PWM vtrack: mode='max'", {
remove_all_vtracks()
pssm <- create_test_pssm() # AC motif
test_interval <- gintervals(1, 200, 240)
extended_interval <- test_interval
extended_interval$end <- extended_interval$end + nrow(pssm) - 1
seq_ext <- toupper(gseq.extract(extended_interval))
# Create virtual track
gvtrack.create("pwm_max", NULL,
func = "pwm.max",
pssm = pssm, bidirect = FALSE, extend = TRUE, prior = 0.01
)
# Extract using gextract
vtrack_result <- gextract("pwm_max", test_interval, iterator = test_interval)
# Score using gseq.pwm
gseq_result <- gseq.pwm(seq_ext, pssm,
mode = "max", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = nchar(seq_ext), extend = TRUE,
skip_gaps = FALSE, prior = 0.01
)
expect_equal(gseq_result, vtrack_result$pwm_max, tolerance = 1e-6)
})
test_that("gseq.pwm matches gextract PWM vtrack: mode='pos'", {
remove_all_vtracks()
pssm <- create_test_pssm() # AC motif
test_interval <- gintervals(1, 200, 240)
extended_interval <- test_interval
extended_interval$end <- extended_interval$end + nrow(pssm) - 1
seq_ext <- toupper(gseq.extract(extended_interval))
# Create virtual track
gvtrack.create("pwm_pos", NULL,
func = "pwm.max.pos",
pssm = pssm, bidirect = FALSE, extend = TRUE, prior = 0.01
)
# Extract using gextract
vtrack_result <- gextract("pwm_pos", test_interval, iterator = test_interval)
# Score using gseq.pwm
gseq_result <- gseq.pwm(seq_ext, pssm,
mode = "pos", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = nchar(seq_ext), extend = TRUE,
skip_gaps = FALSE, prior = 0.01
)
expect_equal(gseq_result, vtrack_result$pwm_pos, tolerance = 1e-6)
})
test_that("gseq.pwm matches gextract PWM vtrack: bidirectional mode", {
remove_all_vtracks()
pssm <- create_test_pssm() # AC motif
test_interval <- gintervals(1, 200, 240)
extended_interval <- test_interval
extended_interval$end <- extended_interval$end + nrow(pssm) - 1
seq_ext <- toupper(gseq.extract(extended_interval))
# Create virtual tracks for bidirectional and forward
gvtrack.create("pwm_bidi", NULL,
func = "pwm",
pssm = pssm, bidirect = TRUE, extend = TRUE, prior = 0.01
)
gvtrack.create("pwm_fwd", NULL,
func = "pwm",
pssm = pssm, bidirect = FALSE, extend = TRUE, prior = 0.01
)
# Extract using gextract
vtrack_result <- gextract(c("pwm_bidi", "pwm_fwd"), test_interval, iterator = test_interval)
# Score using gseq.pwm
pssm_with_prior <- pssm + 0.01
for (i in 1:nrow(pssm_with_prior)) {
pssm_with_prior[i, ] <- pssm_with_prior[i, ] / sum(pssm_with_prior[i, ])
}
gseq_bidi <- gseq.pwm(seq_ext, pssm_with_prior,
mode = "lse", bidirect = TRUE,
start_pos = 1, end_pos = nchar(seq_ext), extend = TRUE,
skip_gaps = FALSE, prior = 0
)
gseq_fwd <- gseq.pwm(seq_ext, pssm_with_prior,
mode = "lse", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = nchar(seq_ext), extend = TRUE,
skip_gaps = FALSE, prior = 0
)
expect_equal(gseq_bidi, vtrack_result$pwm_bidi, tolerance = 1e-6)
expect_equal(gseq_fwd, vtrack_result$pwm_fwd, tolerance = 1e-6)
expect_true(gseq_bidi >= gseq_fwd) # bidirectional should have higher or equal score
})
# ============================================================================
# Comparison tests: gseq.kmer vs gextract with kmer virtual tracks
# ============================================================================
test_that("gseq.kmer matches gextract kmer.count vtrack", {
remove_all_vtracks()
test_interval <- gintervals(1, 200, 240)
seq <- toupper(gseq.extract(test_interval))
# Create virtual track for k-mer count
gvtrack.create("count_ta", NULL, "kmer.count", kmer = "TA", strand = 1)
# Extract using gextract
vtrack_result <- gextract("count_ta", test_interval, iterator = test_interval)
# Score using gseq.kmer
gseq_result <- gseq.kmer(seq, "TA",
mode = "count", strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE
)
expect_equal(gseq_result, vtrack_result$count_ta)
})
test_that("gseq.kmer matches gextract kmer.frac vtrack", {
remove_all_vtracks()
test_interval <- gintervals(1, 200, 240)
seq <- toupper(gseq.extract(test_interval))
# Create virtual track for k-mer fraction
gvtrack.create("frac_ta", NULL, "kmer.frac", kmer = "TA", strand = 1)
# Extract using gextract
vtrack_result <- gextract("frac_ta", test_interval, iterator = test_interval)
# Score using gseq.kmer
gseq_result <- gseq.kmer(seq, "TA",
mode = "frac", strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE
)
expect_equal(gseq_result, vtrack_result$frac_ta, tolerance = 1e-6)
})
test_that("gseq.kmer matches gextract kmer vtrack with longer k-mer", {
remove_all_vtracks()
test_interval <- gintervals(1, 200, 240)
seq <- toupper(gseq.extract(test_interval))
# Create virtual tracks for longer k-mer
gvtrack.create("count_ccc", NULL, "kmer.count", kmer = "CCC", strand = 1)
gvtrack.create("frac_ccc", NULL, "kmer.frac", kmer = "CCC", strand = 1)
# Extract using gextract
vtrack_result <- gextract(c("count_ccc", "frac_ccc"), test_interval, iterator = test_interval)
# Score using gseq.kmer
gseq_count <- gseq.kmer(seq, "CCC",
mode = "count", strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE
)
gseq_frac <- gseq.kmer(seq, "CCC",
mode = "frac", strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE
)
expect_equal(gseq_count, vtrack_result$count_ccc)
expect_equal(gseq_frac, vtrack_result$frac_ccc, tolerance = 1e-6)
})
test_that("gseq.kmer matches gextract kmer vtrack: both strands", {
remove_all_vtracks()
test_interval <- gintervals(1, 200, 240)
seq <- toupper(gseq.extract(test_interval))
# Use "AC" instead of "TA" to avoid palindrome warning
# Create virtual tracks for both strands
gvtrack.create("count_both", NULL, "kmer.count", kmer = "AC", strand = 0)
gvtrack.create("count_fwd", NULL, "kmer.count", kmer = "AC", strand = 1)
gvtrack.create("count_rev", NULL, "kmer.count", kmer = "AC", strand = -1)
# Extract using gextract
vtrack_result <- gextract(c("count_both", "count_fwd", "count_rev"),
test_interval,
iterator = test_interval
)
# Score using gseq.kmer
gseq_both <- gseq.kmer(seq, "AC",
mode = "count", strand = 0,
start_pos = 1, end_pos = nchar(seq), extend = FALSE, skip_gaps = FALSE
)
gseq_fwd <- gseq.kmer(seq, "AC",
mode = "count", strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE, skip_gaps = FALSE
)
gseq_rev <- gseq.kmer(seq, "AC",
mode = "count", strand = -1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE, skip_gaps = FALSE
)
expect_equal(gseq_both, vtrack_result$count_both)
expect_equal(gseq_fwd, vtrack_result$count_fwd)
expect_equal(gseq_rev, vtrack_result$count_rev)
})
# ============================================================================
# Tests for gap support in gseq.pwm() and gseq.kmer()
# ============================================================================
test_that("gseq.pwm with gaps: basic containment", {
# Create PSSM for "GAAC" motif
pssm <- matrix(c(
1e-10, 1e-10, 1.0, 1e-10, # Position 1: G
1.0, 1e-10, 1e-10, 1e-10, # Position 2: A
1.0, 1e-10, 1e-10, 1e-10, # Position 3: A
1e-10, 1.0, 1e-10, 1e-10 # Position 4: C
), nrow = 4, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with gaps: GAAC split by gaps
seq <- "CTGA----ACGGGGG"
# 123456789012345
# With skip_gaps=TRUE, should find GAAC at position 3
result_gap <- gseq.pwm(seq, pssm,
mode = "pos", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 15, extend = FALSE, skip_gaps = TRUE,
prior = 0
)
expect_equal(result_gap, 3) # Physical position of G
# With skip_gaps=FALSE, should not find a good match
result_nogap <- gseq.pwm(seq, pssm,
mode = "pos", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 15, extend = FALSE, skip_gaps = FALSE
)
# The GAAC is interrupted by gaps, so no perfect match
expect_true(is.na(result_nogap) || result_nogap != 3)
})
test_that("gseq.pwm with gaps: ROI and extend", {
# Create PSSM for "AC"
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10, # A
1e-10, 1.0, 1e-10, 1e-10 # C
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with "AC" contiguous at positions 11-12 (gaps elsewhere)
seq <- "GGGG-A--GGAC-GGGG"
# 12345678901234567
# ROI at 12-12 (where C is) with extend=TRUE should find AC
# With extend=1, scans positions 11-13, which includes the AC window (11-12)
result <- gseq.pwm(seq, pssm,
mode = "count", bidirect = FALSE, strand = 1,
start_pos = 12, end_pos = 12, extend = TRUE, skip_gaps = TRUE,
prior = 0
)
expect_equal(result, 1)
})
test_that("gseq.pwm with gaps: reverse strand", {
# Create PSSM for "AC"
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence with GT (reverse complement of AC) split by gaps
seq <- "GGG-G--T-GGGG"
# 1234567890123
result <- gseq.pwm(seq, pssm,
mode = "pos", bidirect = FALSE, strand = -1,
start_pos = 1, end_pos = 13, extend = FALSE, skip_gaps = TRUE, return_strand = TRUE,
prior = 0
)
expect_true(is.data.frame(result))
expect_equal(result$pos, 5) # Position of first G in GT (pos 4 is a gap, pos 5 is G)
expect_equal(result$strand, -1)
})
test_that("gseq.pwm with gaps: all gaps / too few non-gaps", {
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# All gaps
seq_all_gaps <- "-----"
result_lse <- gseq.pwm(seq_all_gaps, pssm, mode = "lse", prior = 0, skip_gaps = TRUE)
expect_true(is.na(result_lse))
result_count <- gseq.pwm(seq_all_gaps, pssm, mode = "count", prior = 0, skip_gaps = TRUE)
expect_equal(result_count, 0)
# Only one non-gap base (need 2 for motif width)
seq_one_base <- "---A---"
result_lse2 <- gseq.pwm(seq_one_base, pssm, mode = "lse", prior = 0, skip_gaps = TRUE)
expect_true(is.na(result_lse2))
})
test_that("gseq.pwm with gaps: spatial weighting", {
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Two AC motifs split by gaps at different physical positions
seq <- "A-C-GG-A-C-GG"
# 1234567890123
# Spatial weighting should be based on physical positions
spatial_weights <- c(1.0, 0.5) # First position weighted higher
result <- gseq.pwm(seq, pssm,
mode = "lse", bidirect = FALSE, strand = 1,
start_pos = 1, end_pos = 13, extend = FALSE, skip_gaps = TRUE,
spat.factor = spatial_weights, spat.bin = 5
)
expect_true(is.finite(result))
})
test_that("gseq.kmer with gaps: basic matching", {
seq <- "A-CG-A"
# 123456
# With skip_gaps=TRUE, should find "ACG" (A at 1, C at 3, G at 4)
result_gap <- gseq.kmer(seq, "ACG",
mode = "count", strand = 1,
start_pos = 1, end_pos = 6, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result_gap, 1)
# With skip_gaps=FALSE, should not find "ACG"
result_nogap <- gseq.kmer(seq, "ACG",
mode = "count", strand = 1,
start_pos = 1, end_pos = 6, extend = FALSE, skip_gaps = FALSE
)
expect_equal(result_nogap, 0)
})
test_that("gseq.kmer with gaps: fraction mode", {
seq <- "A-A-A-GGG"
# 123456789
# With skip_gaps=TRUE, count "A"s: 3 out of 6 non-gap positions
# But for k=1, there are 6 possible logical starts
result_frac <- gseq.kmer(seq, "A",
mode = "frac", strand = 1,
start_pos = 1, end_pos = 9, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result_frac, 3 / 6) # 3 A's, 6 non-gap bases
})
test_that("gseq.kmer with gaps: fraction mode for k>1", {
seq <- "A-AC-AC"
# 1234567
# Non-gap compacted sequence is "AACAC" (length 5)
# For k=2 there are 4 logical starts; "AC" occurs twice
result_frac <- gseq.kmer(seq, "AC",
mode = "frac", strand = 1,
start_pos = 1, end_pos = 7, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result_frac, 2 / 4)
})
test_that("gseq.kmer with gaps: ROI handling", {
seq <- "GGG-A-C-GGG"
# 12345678901
# ROI covering AC (positions 5-7 physically)
result <- gseq.kmer(seq, "AC",
mode = "count", strand = 1,
start_pos = 5, end_pos = 7, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result, 1)
# ROI before AC
result_before <- gseq.kmer(seq, "AC",
mode = "count", strand = 1,
start_pos = 1, end_pos = 3, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result_before, 0)
})
test_that("gseq.kmer with gaps: reverse strand", {
seq <- "G--T-GGG"
# 12345678
# GT on forward = AC on reverse (rev comp)
result <- gseq.kmer(seq, "AC",
mode = "count", strand = -1,
start_pos = 1, end_pos = 8, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result, 1)
})
test_that("gseq.kmer with gaps: both strands", {
seq <- "A-CG-G-T"
# 12345678
# AC on forward, GT on forward (= AC on reverse)
result <- gseq.kmer(seq, "AC",
mode = "count", strand = 0,
start_pos = 1, end_pos = 8, extend = FALSE, skip_gaps = TRUE
)
expect_equal(result, 2) # AC forward + GT as AC reverse
})
test_that("gseq.kmer with gaps: empty sequence", {
seq <- "-----"
result_count <- gseq.kmer(seq, "AC", mode = "count", skip_gaps = TRUE)
expect_equal(result_count, 0)
result_frac <- gseq.kmer(seq, "AC", mode = "frac", skip_gaps = TRUE)
expect_equal(result_frac, 0)
})
test_that("gseq.kmer with gaps: custom gap characters", {
# Custom gap characters should be honored for k-mer matching
seq <- "A_C.A*C"
# Non-gap compacted sequence is "ACAC" -> two "AC" occurrences
result_custom <- gseq.kmer(seq, "AC",
mode = "count", strand = 1,
skip_gaps = TRUE, gap_chars = c("-", ".", "_", "*")
)
expect_equal(result_custom, 2)
})
test_that("gseq functions with gaps: custom gap characters", {
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Use different gap characters
seq <- "A_C.G-A*C"
# Default gaps: only "-" and "."
result_default <- gseq.pwm(seq, pssm,
mode = "count", bidirect = FALSE, strand = 1,
skip_gaps = TRUE, gap_chars = c("-", ".")
)
expect_true(result_default >= 0)
# Custom gaps: include "_" and "*"
result_custom <- gseq.pwm(seq, pssm,
mode = "count", bidirect = FALSE, strand = 1,
skip_gaps = TRUE, gap_chars = c("-", ".", "_", "*"),
prior = 0
)
expect_equal(result_custom, 2) # AC at positions 1,3 and 6,8
})
test_that("gseq functions: skip_gaps=FALSE preserves original behavior", {
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
seq <- "ACGTACGT"
# Results should be identical with skip_gaps=FALSE and skip_gaps=TRUE on a gap-free sequence
result_false <- gseq.pwm(seq, pssm, mode = "count", prior = 0, skip_gaps = FALSE)
result_true <- gseq.pwm(seq, pssm, mode = "count", prior = 0, skip_gaps = TRUE)
expect_equal(result_false, result_true)
# Same for k-mer
result_kmer_false <- gseq.kmer(seq, "AC", mode = "count", skip_gaps = FALSE)
result_kmer_true <- gseq.kmer(seq, "AC", mode = "count", skip_gaps = TRUE)
expect_equal(result_kmer_false, result_kmer_true)
})
test_that("gseq functions: gap parameters validation", {
pssm <- matrix(c(1.0, 1e-10, 1e-10, 1e-10), nrow = 1)
colnames(pssm) <- c("A", "C", "G", "T")
# Invalid gap_chars
expect_error(gseq.pwm("ACGT", pssm, skip_gaps = TRUE, gap_chars = character(0), prior = 0))
expect_error(gseq.pwm("ACGT", pssm, skip_gaps = TRUE, gap_chars = c("A", "AB"), prior = 0))
expect_error(gseq.pwm("ACGT", pssm, skip_gaps = TRUE, gap_chars = c("-", "-"), prior = 0))
})
test_that("gseq.pwm bidirectional pos returns correct strand", {
# Create PSSM for "AC" (using probabilities)
pssm <- matrix(c(
1.0, 1e-10, 1e-10, 1e-10,
1e-10, 1.0, 1e-10, 1e-10
), nrow = 2, byrow = TRUE)
colnames(pssm) <- c("A", "C", "G", "T")
# Sequence contains only the reverse complement "GT" at positions 4-5
seq <- "GGGGTGG"
result <- gseq.pwm(seq, pssm,
mode = "pos", bidirect = TRUE, strand = 1,
start_pos = 1, end_pos = nchar(seq), extend = FALSE, return_strand = TRUE,
skip_gaps = FALSE, prior = 0
)
expect_true(is.data.frame(result))
expect_equal(names(result), c("pos", "strand"))
expect_equal(result$pos, 4)
expect_equal(result$strand, -1)
})
# ============================================================================
# Comparison tests: gseq.pwm vs prego::compute_pwm
# ============================================================================
test_that("gseq.pwm matches prego::compute_pwm: mode='max' with prior", {
skip_if_not_installed("prego")
# Use CTCF motif from prego
ctcf_mot <- prego::HOMER_motifs %>%
dplyr::filter(motif == "CTCF") %>%
dplyr::select(-motif, -pos) %>%
as.matrix()
# Test sequence
seq <- "GTGAACTTCGCTGTCAGCAGAGGGCAACAGGTTCTGCGGG"
# Test with prior=0.01
prego_result <- prego::compute_pwm(seq, ctcf_mot, func = "max", prior = 0.01)
gseq_result <- gseq.pwm(seq, ctcf_mot, mode = "max", prior = 0.01, skip_gaps = FALSE)
expect_equal(gseq_result, prego_result, tolerance = 1e-5)
# Test with prior=0
prego_result_no_prior <- prego::compute_pwm(seq, ctcf_mot, func = "max", prior = 0)
gseq_result_no_prior <- gseq.pwm(seq, ctcf_mot, mode = "max", prior = 0, skip_gaps = FALSE)
expect_equal(gseq_result_no_prior, prego_result_no_prior, tolerance = 1e-5)
})
test_that("gseq.pwm matches prego::compute_pwm: vectorized sequences", {
skip_if_not_installed("prego")
# Use CTCF motif from prego
ctcf_mot <- prego::HOMER_motifs %>%
dplyr::filter(motif == "CTCF") %>%
dplyr::select(-motif, -pos) %>%
as.matrix()
# Multiple test sequences
seqs <- c(
"GTGAACTTCGCTGTCAGCAGAGGGCAACAGGTTCTGCGGG",
"AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA",
"CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC"
)
# Test mode='max' with prior=0.01
prego_results <- sapply(seqs, function(s) {
prego::compute_pwm(s, ctcf_mot, func = "max", prior = 0.01)
})
gseq_results <- gseq.pwm(seqs, ctcf_mot, mode = "max", prior = 0.01, skip_gaps = FALSE)
expect_equal(gseq_results, as.numeric(prego_results), tolerance = 1e-4)
})
# Tests for gseq.kmer.dist ------------------------------------------------
test_that("gseq.kmer.dist counts k-mers correctly", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
# Test k=1 (monomers)
result <- gseq.kmer.dist(intervals, k = 1)
expect_equal(nrow(result), 4) # A, C, G, T
expect_equal(sum(result$count), 1000) # 1000 positions
expect_true(all(c("A", "C", "G", "T") %in% result$kmer))
# Test k=2 (dinucleotides)
result <- gseq.kmer.dist(intervals, k = 2)
expect_equal(nrow(result), 16) # 4^2 = 16
expect_equal(sum(result$count), 999) # 1000 - k + 1 = 999
# Test k=3 (trinucleotides)
result <- gseq.kmer.dist(intervals, k = 3)
expect_equal(sum(result$count), 998) # 1000 - k + 1 = 998
})
test_that("gseq.kmer.dist validates k parameter", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
expect_error(gseq.kmer.dist(intervals, k = 0), "k must be an integer between 1 and 10")
expect_error(gseq.kmer.dist(intervals, k = 11), "k must be an integer between 1 and 10")
expect_error(gseq.kmer.dist(intervals, k = -1), "k must be an integer between 1 and 10")
})
test_that("gseq.kmer.dist mask excludes positions correctly", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
# Without mask
result_no_mask <- gseq.kmer.dist(intervals, k = 3)
total_no_mask <- sum(result_no_mask$count)
# With mask that covers 100 bp
mask <- data.frame(chrom = "chr1", start = 500, end = 600)
result_with_mask <- gseq.kmer.dist(intervals, k = 3, mask = mask)
total_with_mask <- sum(result_with_mask$count)
# Mask should reduce the count by exactly 100 positions
expect_equal(total_no_mask - total_with_mask, 100)
})
test_that("gseq.kmer.dist handles multiple intervals", {
gdb.init_examples()
# Two disjoint intervals
intervals <- data.frame(
chrom = c("chr1", "chr1"),
start = c(0, 2000),
end = c(1000, 3000)
)
result <- gseq.kmer.dist(intervals, k = 2)
# 2 intervals x (1000 - 1) = 1998 dinucleotides
expect_equal(sum(result$count), 1998)
})
test_that("gseq.kmer.dist handles multiple chromosomes", {
gdb.init_examples()
intervals <- data.frame(
chrom = c("chr1", "chr2"),
start = c(0, 0),
end = c(1000, 1000)
)
result <- gseq.kmer.dist(intervals, k = 1)
expect_equal(sum(result$count), 2000)
})
test_that("gseq.kmer.dist returns correct data frame structure", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
result <- gseq.kmer.dist(intervals, k = 4)
expect_true(is.data.frame(result))
expect_equal(names(result), c("kmer", "count"))
expect_true(is.character(result$kmer))
expect_true(is.numeric(result$count))
expect_true(all(nchar(result$kmer) == 4)) # All k-mers have length k
})
test_that("gseq.kmer.dist only returns non-zero counts", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 100)
result <- gseq.kmer.dist(intervals, k = 5)
# With only 100bp, not all 4^5 = 1024 possible 5-mers will appear
expect_lt(nrow(result), 1024)
expect_true(all(result$count > 0))
})
test_that("gseq.kmer.dist handles interval shorter than k", {
gdb.init_examples()
# Interval of 3bp with k=6 should return empty result
intervals <- data.frame(chrom = "chr1", start = 0, end = 3)
result <- gseq.kmer.dist(intervals, k = 6)
expect_equal(nrow(result), 0)
expect_equal(sum(result$count), 0)
# Interval of 5bp with k=6 should return empty result
intervals <- data.frame(chrom = "chr1", start = 0, end = 5)
result <- gseq.kmer.dist(intervals, k = 6)
expect_equal(nrow(result), 0)
# Interval of 6bp with k=6 should return exactly 1 k-mer
intervals <- data.frame(chrom = "chr1", start = 0, end = 6)
result <- gseq.kmer.dist(intervals, k = 6)
expect_equal(sum(result$count), 1)
})
test_that("gseq.kmer.dist matches manual counting from gseq.extract", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 500)
# Get sequence (gseq.extract returns a character vector in lowercase)
seq <- toupper(gseq.extract(intervals)[1])
# Count dinucleotides manually
manual_counts <- list()
for (i in 1:(nchar(seq) - 1)) {
dinuc <- substr(seq, i, i + 1)
if (!grepl("N", dinuc)) {
if (is.null(manual_counts[[dinuc]])) {
manual_counts[[dinuc]] <- 0
}
manual_counts[[dinuc]] <- manual_counts[[dinuc]] + 1
}
}
# Get counts from gseq.kmer.dist
result <- gseq.kmer.dist(intervals, k = 2)
result_list <- setNames(as.list(result$count), result$kmer)
# Compare
for (kmer in names(manual_counts)) {
expect_equal(result_list[[kmer]], manual_counts[[kmer]],
info = sprintf("Mismatch for k-mer %s", kmer)
)
}
})
test_that("gseq.kmer.dist handles mask at interval boundaries", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 100, end = 200)
# Mask at the beginning of interval [100, 120)
mask_start <- data.frame(chrom = "chr1", start = 100, end = 120)
result_mask_start <- gseq.kmer.dist(intervals, k = 2, mask = mask_start)
# Mask at the end of interval [180, 200)
mask_end <- data.frame(chrom = "chr1", start = 180, end = 200)
result_mask_end <- gseq.kmer.dist(intervals, k = 2, mask = mask_end)
result_no_mask <- gseq.kmer.dist(intervals, k = 2)
# Without mask: 99 dinucleotides (positions 100-198)
expect_equal(sum(result_no_mask$count), 99)
# Mask at start [100, 120) covers dinucleotide starts at 100-119 = 20 positions
expect_equal(sum(result_no_mask$count) - sum(result_mask_start$count), 20)
# Mask at end [180, 200) covers dinucleotide starts at 180-198 = 19 positions
# (position 199 can't start a dinucleotide in interval ending at 200)
expect_equal(sum(result_no_mask$count) - sum(result_mask_end$count), 19)
})
test_that("gseq.kmer.dist handles overlapping intervals correctly", {
gdb.init_examples()
# Two overlapping intervals
intervals <- data.frame(
chrom = c("chr1", "chr1"),
start = c(0, 500),
end = c(1000, 1500)
)
result <- gseq.kmer.dist(intervals, k = 2)
# Should count k-mers from both intervals (including overlap region twice)
# Total: (1000-1) + (1000-1) = 1998 dinucleotides
expect_equal(sum(result$count), 1998)
})
test_that("gseq.kmer.dist handles multiple mask intervals", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
# Multiple mask regions
mask <- data.frame(
chrom = c("chr1", "chr1", "chr1"),
start = c(100, 300, 700),
end = c(150, 400, 800)
)
result_no_mask <- gseq.kmer.dist(intervals, k = 3)
result_with_mask <- gseq.kmer.dist(intervals, k = 3, mask = mask)
# Total masked: 50 + 100 + 100 = 250
expected_diff <- 250
actual_diff <- sum(result_no_mask$count) - sum(result_with_mask$count)
expect_equal(actual_diff, expected_diff)
})
test_that("gseq.kmer.dist with k=10 works", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
result <- gseq.kmer.dist(intervals, k = 10)
# Should have 1000 - 10 + 1 = 991 10-mers
expect_equal(sum(result$count), 991)
expect_true(all(nchar(result$kmer) == 10))
})
test_that("gseq.kmer.dist with gintervals.all works", {
gdb.init_examples()
result <- gseq.kmer.dist(gintervals.all(), k = 2)
# Should have all 16 dinucleotides
expect_equal(nrow(result), 16)
# Total should be positive and less than or equal to sum of (chrom_size - 1)
# (may be less if there are N's in the sequence)
all_intervals <- gintervals.all()
max_possible <- sum(all_intervals$end - all_intervals$start - 1)
expect_gt(sum(result$count), 0)
expect_lte(sum(result$count), max_possible)
})
test_that("gseq.kmer.dist k-mer strings are sorted alphabetically", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 10000)
result <- gseq.kmer.dist(intervals, k = 3)
# Check that the result is sorted by kmer
expect_equal(result$kmer, sort(result$kmer))
})
test_that("gseq.kmer.dist handles mask on different chromosome", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
# Mask on chr2 should have no effect on chr1 intervals
mask <- data.frame(chrom = "chr2", start = 0, end = 500)
result_no_mask <- gseq.kmer.dist(intervals, k = 2)
result_with_mask <- gseq.kmer.dist(intervals, k = 2, mask = mask)
expect_equal(sum(result_no_mask$count), sum(result_with_mask$count))
})
test_that("gseq.kmer.dist is deterministic", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 5000)
result1 <- gseq.kmer.dist(intervals, k = 4)
result2 <- gseq.kmer.dist(intervals, k = 4)
expect_identical(result1, result2)
})
test_that("gseq.kmer.dist handles adjacent intervals", {
gdb.init_examples()
# Two adjacent intervals
intervals_adjacent <- data.frame(
chrom = c("chr1", "chr1"),
start = c(0, 1000),
end = c(1000, 2000)
)
# One continuous interval
intervals_continuous <- data.frame(chrom = "chr1", start = 0, end = 2000)
result_adjacent <- gseq.kmer.dist(intervals_adjacent, k = 3)
result_continuous <- gseq.kmer.dist(intervals_continuous, k = 3)
# Adjacent should have 2 fewer k-mers (one at each boundary)
expect_equal(
sum(result_continuous$count) - sum(result_adjacent$count),
2
)
})
test_that("gseq.kmer.dist with mask covering entire interval returns empty", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 100, end = 200)
mask <- data.frame(chrom = "chr1", start = 0, end = 500)
result <- gseq.kmer.dist(intervals, k = 2, mask = mask)
expect_equal(nrow(result), 0)
expect_equal(sum(result$count), 0)
})
test_that("gseq.kmer.dist k-mer counts are consistent across k values", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 1000)
# Monomers should sum to interval length
mono <- gseq.kmer.dist(intervals, k = 1)
expect_equal(sum(mono$count), 1000)
# Each k should have (length - k + 1) k-mers
for (k in 2:6) {
result <- gseq.kmer.dist(intervals, k = k)
expect_equal(sum(result$count), 1000 - k + 1,
info = sprintf("Failed for k=%d", k)
)
}
})
test_that("gseq.kmer.dist frequencies sum correctly", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 10000)
result <- gseq.kmer.dist(intervals, k = 3)
# Convert to frequencies
freqs <- result$count / sum(result$count)
# Frequencies should sum to 1
expect_equal(sum(freqs), 1, tolerance = 1e-10)
})
test_that("gseq.kmer.dist handles very small intervals", {
gdb.init_examples()
# Interval of length 1 with k=2 should return empty result
intervals <- data.frame(chrom = "chr1", start = 100, end = 101)
result <- gseq.kmer.dist(intervals, k = 2)
expect_equal(nrow(result), 0)
expect_equal(sum(result$count), 0)
})
test_that("gseq.kmer.dist reverse complement k-mers are counted separately", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 10000)
result <- gseq.kmer.dist(intervals, k = 2)
# AT and AT are same, but CG and CG are different from GC
# AA and TT are reverse complements
aa_count <- result$count[result$kmer == "AA"]
tt_count <- result$count[result$kmer == "TT"]
# They should be counted separately (not combined)
expect_true(aa_count > 0)
expect_true(tt_count > 0)
})
test_that("gseq.kmer.dist handles unsorted intervals", {
gdb.init_examples()
# Unsorted intervals
intervals_unsorted <- data.frame(
chrom = c("chr1", "chr1"),
start = c(2000, 0),
end = c(3000, 1000)
)
# Sorted intervals
intervals_sorted <- data.frame(
chrom = c("chr1", "chr1"),
start = c(0, 2000),
end = c(1000, 3000)
)
result_unsorted <- gseq.kmer.dist(intervals_unsorted, k = 2)
result_sorted <- gseq.kmer.dist(intervals_sorted, k = 2)
# Should give same results
expect_equal(sum(result_unsorted$count), sum(result_sorted$count))
})
test_that("gseq.kmer.dist handles mask larger than interval", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 500, end = 600)
mask <- data.frame(chrom = "chr1", start = 0, end = 1000)
result <- gseq.kmer.dist(intervals, k = 2, mask = mask)
expect_equal(nrow(result), 0)
})
test_that("gseq.kmer.dist handles partial mask overlap", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 100)
# Mask overlaps only partially [50, 150)
mask <- data.frame(chrom = "chr1", start = 50, end = 150)
result_no_mask <- gseq.kmer.dist(intervals, k = 2)
result_with_mask <- gseq.kmer.dist(intervals, k = 2, mask = mask)
# For k=2, positions 0-98 can start a dinucleotide (99 total)
# Mask covers positions 50-99 in our interval
# K-mers starting at positions 50-98 are masked (49 k-mers)
expect_equal(sum(result_no_mask$count) - sum(result_with_mask$count), 49)
})
test_that("gseq.kmer.dist with all possible k values", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 100)
for (k in 1:10) {
result <- gseq.kmer.dist(intervals, k = k)
# All k-mers should have correct length
expect_true(all(nchar(result$kmer) == k),
info = sprintf("k=%d has wrong k-mer lengths", k)
)
# Total count should be length - k + 1 (if >= k)
expected <- max(0, 100 - k + 1)
expect_equal(sum(result$count), expected,
info = sprintf("k=%d has wrong total count", k)
)
}
})
test_that("gseq.kmer.dist GC content matches monomer frequencies", {
gdb.init_examples()
intervals <- data.frame(chrom = "chr1", start = 0, end = 10000)
result <- gseq.kmer.dist(intervals, k = 1)
g_count <- result$count[result$kmer == "G"]
c_count <- result$count[result$kmer == "C"]
total <- sum(result$count)
gc_content <- (g_count + c_count) / total
# Verify this matches what we'd get from sequence
# gseq.extract returns lowercase, so uppercase before comparing
seq <- toupper(gseq.extract(intervals)[1])
gc_from_seq <- (nchar(gsub("[^GC]", "", seq))) / nchar(seq)
expect_equal(gc_content, gc_from_seq, tolerance = 1e-10)
})
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.