Description Usage Arguments Details Value Author(s) Examples
Given a sequence generate a vector of subsequences
1 | ns.gen.tile(seq,len=60,step=1,circular=0)
|
seq |
A sequences in standard IUB/IUPAC nucleic acid codes |
len |
the length of the subsequence |
step |
the step size |
circular |
if not zero assume a circular sequence |
It is ment for genetic sequences but will work for any string.
A vector of strings containing the subsequences
Wim de Leeuw
1 | ns.gen.tile("CGCGGGGCATTATATCTACTACTAGTATCT",10,2);
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.