Description Usage Arguments Details Value Author(s) Examples
Calculate reverse complement of a sequence
1 |
s |
a vector of sequences in standard IUB/IUPAC nucleic acid codes |
Codes which represent non determined nucleotides will be handled.
A vector of sequences giving the reverse complement of the entered sequences
Wim de Leeuw
1 | ns.reverse.complement(c("ATATATATA","CCCCGGGCGCG","CGCGGGGCATTATATCTACTACTAGTATCT"));
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.