Description Usage Arguments Value Author(s) Examples
Calculate the number of cycles which would be required to produce the sequence on a Nimblegen micro-array.
1 |
s |
a vector of strings representing the sequences. |
A vector of integers giving the number of cycles needed of all entered sequences
Wim de Leeuw
1 | ns.nimblegen.cycles(c("ATATATATA","CCCCGGGCGCG","CGCGGGGCATTATATCTACTACTAGTATCT"));
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.