Description Usage Arguments Details Value Note Author(s) Examples
Calculate the self-hybridization dG for a vector of sequences at a given temerature, using hybrid-ss-min from Unafold package.
1 | ns.dg.self.hybridization(s, t = 75, c.Na = 1, c.Mg = 0,acid.type=c("DNA","RNA"))
|
s |
a vector of sequences in standard IUB/IUPAC nucleic acid codes |
t |
the temperature at which dG is calculated |
c.Na |
Natrium concentration at which dG is calculated |
c.Mg |
Magnesium concentration at which dG is calculated |
acid.type |
Calculate dG for DNA or RNA |
Currently only sequences containing determined nucleotides (ACGT) will produce output.
A vector of reals giving the dG for all entered sequences
The calculation is performed by calling the external program hybrid-ss-min. This program is part of the UNAFold nucleic acid folding package by Michael Zuker and Nick Markham. This package must be installed to in order to use the function.
Wim de Leeuw
1 | ns.dg.self.hybridization(c("ATATATATA","CCCCGGGCGCG","CGCGGGGCATTATATCTACTACTAGTATCT"));
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.