ns.blat: Perform a sequence-alignment using blat
In UvA-MAD/SeqLibR: Sequence Library

Description Usage Arguments Details Value Author(s) Examples

Calculate alignments of one or more query sequences to a sequence database using the blat tool.

1	ns.blat(query, database, eval = 10, tileSize = 10, add.parm = "")

`query`	A character vector containing the sequence(s) to be aligned. The character vector is interprented fasta file where elements in the vector are lines.
`database`	A reference to the database to align with.
`eval`	Numerical threshold e-value. Only alignments with an e-value equal or smaller than `eval` will be returned
`tileSize`	tile size which blat will use See blat documentation for details
`add.parm`	Additional options to be passed to blat can be set here.

The function executes "blat ....." and retrieves the results. Execute system("blat") to get an overview of the options which can be passed to the add.parm.

The function returns a data.frame containing the blat result for all submitted sequences; one row per alignment. The columns in the output contain the following information with respect to the alignment.

`query`	Name of query sequence.
`sequence`	Name of sequence in the data base.
`mlength`	Length of the match.
`identity`	percent identy of the match.
`mismatches`	The number of mismatches in the alignment.
`gaps`	The number of gaps in the alignment.
`qstart`	The start of the match in the query.
`qstop`	The end of the match in the query.
`sstart`	The start of the match in the query.
`sstop`	The end of the match in the query.
`eval`	The e-value of the match.
`bitscore`	The the bit-score of the match.

Wim de Leeuw (w.c.deLeeuw@uva.nl)

  ts = c("sequence_1"="ATGCGCGTACATCGCCCCCCCGGGGGG","sequence_2"="TCCCCCCCCGGGGGGATCTTATATATATCCCCCGGGGG")
  # Self-self blat 
  ns.blat(ts,ts);
  # Blat some sequecnes
  ns.blat(c("query_A"="TCGCCCCCCCGGGGGG","query_B"="GATCTTATATATATCCC"),ts,my.db,eval=1)