Description Usage Arguments Details Value Author(s) Examples
Calculate CG content of a sequence
1 |
s |
a vector of sequences in standard IUB/IUPAC nucleic acid codes |
Codes which represent non determined nucleotides will be countet as if the probability for each nucleotide is equal. For example D (G, A or T) will be counted as 0.33333.
A vector of reals giving the cg-content of all entered sequences
Wim de Leeuw
1 | ns.cg.content(c("ATATATATA","CCCCGGGCGCG","CGCGGGGCATTATATCTACTACTAGTATCT"));
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.