Description Usage Arguments Details Value Author(s) References Examples
Calculate alignments of one or more sequences in fasta format to a sequence database using the blast tools. The sequence database is set up using init.blast.
1 |
x |
A character vector containing the sequence(s) to be blasted. The character vector is interprented a fasta file where elements in the vector are lines. |
database |
A reference to the database to blast against, use the output of the function |
eval |
Numerical threshold e-value. Only alignments with an e-value equal or smaller than |
filter |
If |
add.parm |
Additional options to be passed to blastn can be set here. For example to lower the gap penalty use add.parm = "-gapextend -2" |
The function executes "blastn ....." and retrieves the results. Execute system("blastn -help") to get an overview of the options which can be passed to the add.parm.
The function returns a data.frame containing the blast result for all submitted sequences; one row per alignment. The columns in the output contain the following information with respect to the alignment.
query |
Name of query sequence. |
sequence |
Name of sequence in the data base. |
mlength |
Length of the match. |
identity |
percent identy of the match. |
mismatches |
The number of mismatches in the alignment. |
gaps |
The number of gaps in the alignment. |
qstart |
The start of the match in the query. |
qstop |
The end of the match in the query. |
sstart |
The start of the match in the query. |
sstop |
The end of the match in the query. |
eval |
The e-value of the match. |
bitscore |
The the bit-score of the match. |
Wim de Leeuw (w.c.deLeeuw@uva.nl)
Blast: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaeffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
1 2 3 4 5 6 | ts = c("sequence_1"="ATGCGCGTACATCGCCCCCCCGGGGGG","sequence_2"="TCCCCCCCCGGGGGGATCTTATATATATCCCCCGGGGG")
# Self-self blast
ns.blast(ts,ns.blast.db(sequences=ts))
# Blast some sequecnes
my.db <- ns.blast.db(sequences=ts)
ns.blast(c("query_A"="TCGCCCCCCCGGGGGG","query_B"="GATCTTATATATATCCC"),my.db,eval=1)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.