salmonCounts: A function to handle a salmon docker container

Description Usage Arguments Author(s) Examples

View source: R/salmonCounts.R

Description

This function executes a docker that produces as output the transcripts count file generated by Salmon quasi-alignment

Usage

1
2
3
salmonCounts(group = c("sudo", "docker"), scratch.folder, fastq.folder,
  index.folder, threads = 8, seq.type = c("se", "pe"),
  strandness = c("none", "forward", "reverse"))

Arguments

group,

a character string. Two options: sudo or docker, depending to which group the user belongs

scratch.folder,

a character string indicating the path of the scratch folder

fastq.folder,

a character string indicating the folder where input data are located and where output will be written

index.folder,

a character string indicating the folder where transcriptome index was created with salmonIndex.

threads,

a number indicating the number of cores to be used from the application

seq.type,

a character string indicating the type of reads to be generated by the sequencer. Two options: "se" or "pe" respectively for single end and pair end sequencing. Strandness is inferred by salmon.

strandness,

a character string indicating the type ofsequencing protocol used for the analysis. Three options: "none", "forward", "reverse" respectively for non strand selection, reverse for Illumina strandness protocols, reverse for ACCESS Illumina protocol

Author(s)

Raffaele Calogero, raffaele.calogero [at] unito [dot] it, Bioinformatics and Genomics unit, University of Torino Italy

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
## Not run: 
system("wget http://130.192.119.59/public/test_R1.fastq.gz")
system("wget http://130.192.119.59/public/test_R2.fastq.gz")
library(docker4seq)
wrapperSalmon(group="docker", scratch.folder="/data/scratch/",
              fastq.folder=getwd(), index.folder="/data/genomes/hg38salmon",
              threads=24, seq.type="pe", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
              adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", min.length=40, strandness="none")

## End(Not run)

kendomaniac/docker4seq documentation built on Nov. 8, 2018, 6:49 p.m.