#' @title A function to handle a salmon docker container
#' @description This function executes a docker that produces as output the transcripts count file generated by Salmon quasi-alignment
#' @param group, a character string. Two options: sudo or docker, depending to which group the user belongs
#' @param scratch.folder, a character string indicating the path of the scratch folder
#' @param fastq.folder, a character string indicating the folder where input data are located and where output will be written
#' @param threads, a number indicating the number of cores to be used from the application
#' @param seq.type, a character string indicating the type of reads to be generated by the sequencer. Two options: \code{"se"} or \code{"pe"} respectively for single end and pair end sequencing. Strandness is inferred by salmon.
#' @param index.folder, a character string indicating the folder where transcriptome index was created with salmonIndex.
#' @param strandness, a character string indicating the type ofsequencing protocol used for the analysis. Three options: \code{"none"}, \code{"forward"}, \code{"reverse"} respectively for non strand selection, reverse for Illumina strandness protocols, reverse for ACCESS Illumina protocol
#' @author Raffaele Calogero, raffaele.calogero [at] unito [dot] it, Bioinformatics and Genomics unit, University of Torino Italy
#'
#' @examples
#' \dontrun{
#' system("wget http://130.192.119.59/public/test_R1.fastq.gz")
#' system("wget http://130.192.119.59/public/test_R2.fastq.gz")
#' library(docker4seq)
#' wrapperSalmon(group="docker", scratch.folder="/data/scratch/",
#' fastq.folder=getwd(), index.folder="/data/genomes/hg38salmon",
#' threads=24, seq.type="pe", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
#' adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", min.length=40, strandness="none")
#' }
#'
#' @export
salmonCounts <- function(group=c("sudo","docker"), scratch.folder, fastq.folder, index.folder, threads=8, seq.type=c("se","pe"), strandness=c("none", "forward", "reverse")){
#storing the position of the home folder
home <- getwd()
#running time 1
ptm <- proc.time()
#setting the data.folder as working folder
if (!file.exists(fastq.folder)){
cat(paste("\nIt seems that the ",fastq.folder, " folder does not exist\n"))
return(2)
}
setwd(fastq.folder)
#initialize status
system("echo 0 > ExitStatusFile 2>&1")
#testing if docker is running
test <- dockerTest()
if(!test){
cat("\nERROR: Docker seems not to be installed in your system\n")
system("echo 10 > ExitStatusFile 2>&1")
setwd(home)
return(10)
}
#check if scratch folder exist
if (!file.exists(scratch.folder)){
cat(paste("\nIt seems that the ",scratch.folder, " folder does not exist\n"))
system("echo 3 > ExitStatusFile 2>&1")
setwd(home)
return(3)
}
tmp.folder <- gsub(":","-",gsub(" ","-",date()))
scrat_tmp.folder=file.path(scratch.folder, tmp.folder)
writeLines(scrat_tmp.folder,paste(fastq.folder,"/tempFolderID", sep=""))
cat("\ncreating a folder in scratch folder\n")
dir.create(file.path(scrat_tmp.folder))
dir <- dir()
dir <- dir[grep(".fastq.gz$", dir)]
dir.trim <- dir[grep("trimmed", dir)]
cat("\ncopying \n")
if(length(dir)==0){
cat(paste("It seems that in ", fastq.folder, "there are not fastq.gz files"))
return(1)
}else if(length(dir.trim)>0){
dir <- dir.trim
system(paste("chmod 777 -R", file.path(scratch.folder, tmp.folder)))
for(i in dir){
system(paste("cp ",fastq.folder,"/",i, " ",scratch.folder,"/",tmp.folder,"/",i, sep=""))
}
system(paste("chmod 777 -R", file.path(scratch.folder, tmp.folder)))
}else if(length(dir)>2){
cat(paste("It seems that in ", fastq.folder, "there are more than two fastq.gz files"))
system("echo 2 > ExitStatusFile 2>&1")
setwd(home)
return(2)
}else{
system(paste("chmod 777 -R", file.path(scratch.folder, tmp.folder)))
for(i in dir){
system(paste("cp ",fastq.folder,"/",i, " ",scratch.folder,"/",tmp.folder,"/",i, sep=""))
}
system(paste("chmod 777 -R", file.path(scratch.folder, tmp.folder)))
}
#Trimmed fastq linking fpr docker
docker_fastq.folder=scrat_tmp.folder
#Trimmed fastq linking fpr docker
system(paste("gzip -d ",docker_fastq.folder,"/*.gz", sep=""))
fastq <- sub(".gz$", "", dir)
cat("\nsetting as working dir the scratch folder and running docker container\n")
#executing the docker job
if(strandness=="none"){
if(group=="sudo"){
if(seq.type=="pe"){
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",docker_fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/salmon.2017.01 sh /bin/salmon_countsPE.sh ", threads," ", fastq[1]," ", fastq[2]," ", fastq.folder, sep="")
resultRun <- runDocker(group="sudo", params=params)
}else{
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",docker_fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/salmon.2017.01 sh /bin/salmon_countsSE.sh ", threads," ", fastq[1]," ", fastq.folder, sep="")
resultRun <- runDocker(group="sudo", params=params)
}
}else{
if(seq.type=="pe"){
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",docker_fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/salmon.2017.01 sh /bin/salmon_countsPE.sh ", threads," ", fastq[1]," ", fastq[2]," ", fastq.folder, sep="")
resultRun <- runDocker(group="docker", params=params)
}else{
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",docker_fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/salmon.2017.01 sh /bin/salmon_countsSE.sh ", threads," ", fastq[1]," ", fastq.folder, sep="")
resultRun <- runDocker(group="docker", params=params)
}
}
}else{
cat("\nNot implemented, yet\n")
system("echo 11 > ExitStatusFile 2>&1")
setwd(home)
return(11)
}
#waiting for the end of the container work
if(resultRun==0){
#not saving fastq files
dir.tmp <- dir(scrat_tmp.folder)
dir.tmp <- setdiff(dir.tmp, dir.tmp[grep("fastq",dir.tmp)])
for(i in dir.tmp){
system(paste("cp ", scrat_tmp.folder, "/", i, " " , fastq.folder, sep=""))
}
#saving log and removing docker container
container.id <- readLines(paste(fastq.folder,"/dockerID", sep=""), warn = FALSE)
system(paste("docker logs ", substr(container.id,1,12), " &> ","salmonCounts_",substr(container.id,1,12),".log", sep=""))
system(paste("docker rm ", container.id, sep=""))
#removing temporary folder
cat("\n\nRemoving the temporary file ....\n")
system(paste("rm -R ",scrat_tmp.folder))
# system("rm -fR out.info")
system("rm -fR dockerID")
system("rm -fR tempFolderID")
system(paste("cp ",paste(path.package(package="docker4seq"),"containers/containers.txt",sep="/")," ",fastq.folder, sep=""))
}
#running time 2
ptm <- proc.time() - ptm
dir <- dir(fastq.folder)
dir <- dir[grep("run.info",dir)]
if(length(dir)>0){
con <- file("run.info", "r")
tmp.run <- readLines(con)
close(con)
tmp.run[length(tmp.run)+1] <- paste("user run time mins ",ptm[1]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("system run time mins ",ptm[2]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("elapsed run time mins ",ptm[3]/60, sep="")
writeLines(tmp.run,"run.info")
}else{
tmp.run <- NULL
tmp.run[1] <- paste("run time mins ",ptm[1]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("system run time mins ",ptm[2]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("elapsed run time mins ",ptm[3]/60, sep="")
writeLines(tmp.run,"run.info")
}
setwd(home)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.