tests/testthat/test_count_codons.R

In santiago1234/codonr: What The Package Does (one line, title case required)

context("count codons")

dna <- "ATGGCAAGGCCCAAAGTGTTTTTCGATCTGACCGCCGGCGGCAGTCCTGTTGGAAGGGTGGTAATGGAG"
output <- count_codons(dna)

test_that("number of counts equals number of codons", {
  expect_equal(sum(output$n), nchar(dna) / 3)
})

test_that("correct number of counts", {
  dna1 <- "ACGacgACGtttACG"
  outpu1 <- count_codons(dna1)
  expect_equal(dplyr::filter(outpu1, codon == "ACG")$n, 4)
  expect_false("CGA" %in% outpu1$codon)
  expect_error(count_codons("A"))
})


# test get_codons ---------------------------------------------------------

context("get codons")

test_that("expected output", {
  codons <- get_codons()
  expect_equal(length(codons), 64)
  expect_equal(unique(length(codons)), 64)
  expect_true("ATG" %in% codons)
  ## no stop codons
  codons <- get_codons(FALSE)
  expect_equal(length(codons), 61)
  expect_false("TAG" %in% codons)
})


context("codon composition")
# test codon composition function -----------------------------------------

## create today data set
set.seed(10)
n <- 100
## generate fake data set for testing
Reduce(function(x, y) paste0(x, y), sample(c("A", "C", "G", "T"), n * 3, replace = T))
cds <- replicate(
  n,
  expr = Reduce(
    function(x, y) paste0(x, y),
    sample(c("A", "C", "G", "T"), rpois(n = 1, lambda = 100) * 3, replace = T)
  )
)
ids <- paste0("id_", rnorm(100))
data <- tibble::tibble(ids = ids, cds = cds)
output <- codon_composition(data, id_col = "ids", orf_col = "cds")

test_that("correct output", {
  expect_equal(nrow(data), nrow(output))
  expect_false(any(duplicated(output$id_col)))
  expect_error(codon_composition(dplyr::bind_rows(data, data), , id_col = "ids", orf_col = "cds"))
  # total sum equal length
  result <-
    tidyr::gather(output, key = "codon", value = "n", -id_col) %>%
    dplyr::group_by(id_col) %>%
    dplyr::summarise(total_codons = sum(n)) %>%
    dplyr::inner_join(data, by = c("id_col" = "ids")) %>%
    dplyr::mutate(expected_codons = nchar(cds) / 3)
  expect_true(all(result$total_codons == result$expected_codons))
})