checkPrimer: checkPrimer

Description Usage Arguments Value Author(s) Examples




checkPrimer(pp, genome, roi = NULL)



data.frame defining primers, or output of callPrimer3. minimal columns = PRIMER_LEFT_SEQUENCE,PRIMER_RIGHT_SEQUENCE


BSgenome object


makeROI object


list of GRanges with primer locations


Diana Low


# create a primer pair
primer_pair <- data.frame(PRIMER_LEFT_SEQUENCE="agctcttgaaattggagctgac",

Search within the SPLINTER package
Search all R packages, documentation and source code

Questions? Problems? Suggestions? or email at

Please suggest features or report bugs with the GitHub issue tracker.

All documentation is copyright its authors; we didn't write any of that.