checkPrimer: checkPrimer

Description

checkPrimer

Usage

1
checkPrimer(pp, genome, roi = NULL)

Arguments

pp

data.frame defining primers, or output of callPrimer3. minimal columns = PRIMER_LEFT_SEQUENCE,PRIMER_RIGHT_SEQUENCE

genome

BSgenome object

roi

makeROI object

Value

list of GRanges with primer locations

Author(s)

Diana Low

Examples

1
2
3
4
5
# create a primer pair
roi
primer_pair <- data.frame(PRIMER_LEFT_SEQUENCE="agctcttgaaattggagctgac",
                          PRIMER_RIGHT_SEQUENCE="cttagaaagaacaggaaatcc",
                          stringsAsFactors=FALSE)

Questions? Problems? Suggestions? or email at ian@mutexlabs.com.

All documentation is copyright its authors; we didn't write any of that.