checkPrimer: checkPrimer

Description Usage Arguments Value Author(s) Examples

View source: R/primerpcr.R




checkPrimer(pp, genome, roi = NULL)



data.frame defining primers, or output of callPrimer3. minimal columns = PRIMER_LEFT_SEQUENCE,PRIMER_RIGHT_SEQUENCE


BSgenome object


makeROI object


list of GRanges with primer locations


Diana Low


# create a primer pair
primer_pair <- data.frame(PRIMER_LEFT_SEQUENCE="agctcttgaaattggagctgac",

SPLINTER documentation built on May 2, 2018, 6:03 p.m.