Nothing
#' Calculate the melting temperature using empirical formulas based on GC content
#'
#' Calculate the melting temperature using empirical formulas based on GC content with different options.
#' The function returns a list of sequences with updated Tm attributes and calculation options.
#'
#' @param gr_seq Pre-processed sequence(s) in 5' to 3' direction. This should be the output from
#' to_genomic_ranges() function.
#'
#' @param ambiguous Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content.
#' The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally
#' distributing their contribution to GC content based on their possible nucleotide compositions.
#'
#' @param userset A vector of four coefficient values. Usersets override value sets.
#'
#' @param variant Empirical constants coefficient with 8 variants:
#' - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N
#' - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch
#' - Schildkraut1965: Tm = 81.5 + 0.41(%GC) - 675/N + 16.6 x log10[Na+]
#' - Wetmur1991_MELTING: Tm = 81.5 + 0.41(%GC) - 500/N + 16.6 x log10([Na+]/(1 + 0.7 x [Na+])) - %mismatch
#' - Wetmur1991_RNA: Tm = 78 + 0.7(%GC) - 500/N + 16.6 x log10([Na+]/(1 + 0.7 x [Na+])) - %mismatch
#' - Wetmur1991_RNA/DNA: Tm = 67 + 0.8(%GC) - 500/N + 16.6 x log10([Na+]/(1 + 0.7 x [Na+])) - %mismatch
#' - Primer3Plus: Tm = 81.5 + 0.41(%GC) - 600/N + 16.6 x log10[Na+]
#' - vonAhsen2001: Tm = 77.1 + 0.41(%GC) - 528/N + 11.7 x log10[Na+]
#'
#' Salt correction is applied only for variants that include it in the formula
#' (via \code{salt_correct()}). Chester1993 and QuikChange use no salt term.
#' D is the mismatch penalty (typically 1): Tm decreases by D x (%mismatch).
#' Use \code{X} (or \code{.}) in the sequence to mark mismatch positions.
#'
#' @param Na Millimolar concentration of sodium ions. Default: 50
#'
#' @param K Millimolar concentration of potassium ions. Default: 0
#'
#' @param Tris Millimolar concentration of Tris buffer. Default: 0
#'
#' @param Mg Millimolar concentration of magnesium ions. Default: 0
#'
#' @param dNTPs Millimolar concentration of deoxynucleotide triphosphates. Default: 0
#'
#' @param salt_method Salt correction method. \code{NULL} (default) uses the
#' method associated with \code{variant}. Set to \code{NA} to disable salt
#' correction. Options:
#' - "Schildkraut2010": Schildkraut & Lifson 1965
#' - "Wetmur1991": Wetmur 1991
#' - "SantaLucia1996": SantaLucia 1996
#' - "SantaLucia1998-1": SantaLucia 1998 (Method 1)
#' - "Owczarzy2004": Owczarzy 2004
#' - "Owczarzy2008": Owczarzy 2008
#' Note: "SantaLucia1998-2" is not available for this function.
#'
#' @param mismatch Logical. If TRUE (default), every 'X' in the sequence is counted as a mismatch
#'
#' @param DMSO Percent DMSO concentration in the reaction mixture. Default: 0
#'
#' @param formamide_unit Formamide concentration as `list(value, unit)`. Default: list(value = 0, unit = "percent")
#' - value: Numeric value of formamide concentration
#' - unit: Either "percent" or "molar"
#'
#' @param dmso_factor Coefficient of Tm decreases per percent DMSO. Default: 0.75 (von Ahsen et al. 2001)
#' Other published values are 0.5, 0.6 and 0.675.
#'
#' @param formamide_factor Coefficient of Tm decrease per percent formamide. Default: 0.65
#' Several papers report factors between 0.6 and 0.72.
#'
#' @returns Returns a list with two components:
#' - Tm: A list of sequences with updated Tm attributes
#' - Options: A list containing calculation parameters and method information
#'
#' @references
#'
#' Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology, 1962, 5(1):109-118.
#'
#' Schildkraut C. Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 2010, 3(2):195-208.
#'
#' Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.
#'
#' Untergasser A, Cutcutache I, Koressaar T, et al. Primer3--new capabilities and interfaces. Nucleic Acids Research, 2012, 40(15):e115-e115.
#'
#' von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
#'
#' @author Junhui Li
#'
#' @examples
#'
#' # Example with multiple sequences
#' input_seq <- c("ATCGTGCGTAGCAGTACGATCAGTAG", "ATCGTGCGTAGCAGTACGATCAGTAG")
#' gr_seq <- to_genomic_ranges(input_seq)
#' out <- tm_gc(gr_seq, ambiguous = TRUE, variant = "Primer3Plus", Na = 50, mismatch = TRUE)
#' out
#' out$Options
#'
#' @export tm_gc
tm_gc <- function(gr_seq,
ambiguous = FALSE,
userset = NULL,
variant = c("Primer3Plus",
"Chester1993",
"QuikChange",
"Schildkraut1965",
"Wetmur1991_MELTING",
"Wetmur1991_RNA",
"Wetmur1991_RNA/DNA",
"vonAhsen2001"),
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010",
"Wetmur1991",
"SantaLucia1996",
"SantaLucia1998-1",
"Owczarzy2004",
"Owczarzy2008"),
mismatch = TRUE,
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65) {
variant <- match.arg(variant)
salt_method <- match.arg(salt_method)
if (is.null(userset)) {
if (!variant %in% rownames(get_table("GC_VARTAB"))) {
stop("only Chester1993, QuikChange, Schildkraut1965, Wetmur1991_MELTING, Wetmur1991_RNA, Wetmur1991_RNA/DNA, Primer3Plus and vonAhsen2001 are allowed in variant")
} else {
gc_coef <- get_table("GC_VARTAB")[variant,]
salt_method <- get_table("GC_VARTAB")[variant,"salt_correct"]
}
} else {
gc_coef <- as.numeric(userset)
salt_method <- salt_method
}
# Filter sequence
gr_seq$sequence <- check_filter_seq(gr_seq$sequence, method = 'tm_gc')
# Calculate Tm for each sequence and update seq_checked
seq_tm <- sapply(seq_along(gr_seq), function(i) {
filtered_seq <- gr_seq$sequence[i]
n_seq <- nchar(filtered_seq)
pt_gc <- gc(filtered_seq, ambiguous = ambiguous)
tm <- gc_coef[1] + gc_coef[2]*pt_gc - gc_coef[3]/n_seq
if (mismatch == TRUE) {
mismatch_count <- sum(filtered_seq %in% 'X')
tm <- tm - gc_coef[4]*(mismatch_count*100/n_seq)
}
if (!is.null(userset)) {
corr_salt <- salt_correct(Na = Na,
K = K,
Tris = Tris,
Mg = Mg,
dNTPs = dNTPs,
method = salt_method,
input_seq = filtered_seq,
ambiguous = ambiguous)
} else {
if (variant %in% c("Schildkraut1965", "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "Primer3Plus", "vonAhsen2001")) {
if (variant == "Schildkraut1965") {
salt_method <- "Schildkraut2010"
} else if (variant == "Wetmur1991_MELTING") {
salt_method <- "Wetmur1991"
} else if (variant == "Wetmur1991_RNA") {
salt_method <- "Wetmur1991"
} else if (variant == "Wetmur1991_RNA/DNA") {
salt_method <- "Wetmur1991"
} else if (variant == "Primer3Plus") {
salt_method <- "Schildkraut2010"
} else if (variant == "vonAhsen2001") {
salt_method <- "SantaLucia1998-1"
}
corr_salt <- salt_correct(Na = Na,
K = K,
Tris = Tris,
Mg = Mg,
dNTPs = dNTPs,
method = salt_method,
input_seq = filtered_seq,
ambiguous = ambiguous)
} else {
corr_salt <- 0
}
}
tm <- tm + corr_salt
if (DMSO > 0 | formamide_unit$value > 0) {
corr_chem <- chem_correct(DMSO = DMSO,
formamide_unit = formamide_unit,
dmso_factor = dmso_factor,
formamide_factor = formamide_factor,
pt_gc = pt_gc)
tm <- tm + corr_chem
}
return(list(Tm = tm, GC = pt_gc))
})
gr_seq$GC <- unlist(seq_tm[2,])
gr_seq$Tm <- unlist(seq_tm[1,])
gr_seq <- .normalize_tm_gc_metadata(gr_seq)
# Create result list with proper structure
df_gr <- as.data.frame(gr_seq)
result_list <- list(
gr = gr_seq,
df = df_gr,
options = list(
Ambiguous = ambiguous,
Method = paste0(variant, " (",
if (variant == "Chester1993") "Chester & Marshak 1993" else
if (variant == "QuikChange") "QuikChange Site-Directed Mutagenesis" else
if (variant == "Schildkraut1965") "Schildkraut & Lifson 1965" else
if (variant == "Wetmur1991_MELTING") "Wetmur 1991 (MELTING)" else
if (variant == "Wetmur1991_RNA") "Wetmur 1991 (RNA)" else
if (variant == "Wetmur1991_RNA/DNA") "Wetmur 1991 (RNA/DNA)" else
if (variant == "Primer3Plus") "Primer3Plus" else
"von Ahsen et al. 2001", ")"),
Na = Na,
K = K,
Tris = Tris,
Mg = Mg,
dNTPs = dNTPs,
"Salt correction" = salt_method,
Mismatch = mismatch,
"Percent of DMSO" = DMSO,
"Formamide concentration" = formamide_unit$value,
"Formamide concentration unit" = formamide_unit$unit,
"DMSO factor" = dmso_factor,
"Formamide factor" = formamide_factor
)
)
# Set class and attributes
class(result_list) <- c("TmCalculator", "list")
attr(result_list, "nonhidden") <- "gr"
return(result_list)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.