| tm_gc | R Documentation |
Calculate the melting temperature using empirical formulas based on GC content with different options. The function returns a list of sequences with updated Tm attributes and calculation options.
tm_gc(
gr_seq,
ambiguous = FALSE,
userset = NULL,
variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
"Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = NULL,
mismatch = TRUE,
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65
)
gr_seq |
Sequence(s) in 5' to 3' direction, as the |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. |
userset |
A vector of four coefficient values. Usersets override value sets. |
variant |
Empirical constants coefficient with 8 variants: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41( - Wetmur1991_MELTING: Tm = 81.5 + 0.41( - Wetmur1991_RNA: Tm = 78 + 0.7( - Wetmur1991_RNA/DNA: Tm = 67 + 0.8( - Primer3Plus: Tm = 81.5 + 0.41( - vonAhsen2001: Tm = 77.1 + 0.41( Salt correction is applied only for variants that include it in the formula
(via |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method:
- With a built-in "SantaLucia1998-2", "Owczarzy2004" and "Owczarzy2008" are not available
for this function. The first corrects the entropy of a nearest-neighbor
model, which a GC-content formula does not have. The other two correct
the reciprocal of the melting temperature in kelvin, referenced to the
same duplex in 1 M Na+, and carry a duplex-length term of their own,
which these formulas already have. All three are available in
|
mismatch |
Logical. If TRUE (default), every 'X' in the sequence is counted as a mismatch |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar" |
dmso_factor |
Coefficient of Tm decreases per percent DMSO. Default: 0.75 (von Ahsen et al. 2001) Other published values are 0.5, 0.6 and 0.675. |
formamide_factor |
Coefficient of Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72. |
Returns a list with two components: - Tm: A list of sequences with updated Tm attributes - Options: A list containing calculation parameters and method information
Junhui Li
Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology, 1962, 5(1):109-118.
Schildkraut C, Lifson S. Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 1965, 3(2):195-208.
Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.
Untergasser A, Cutcutache I, Koressaar T, et al. Primer3–new capabilities and interfaces. Nucleic Acids Research, 2012, 40(15):e115-e115.
von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
# Example with multiple sequences
input_seq <- c("ATCGTGCGTAGCAGTACGATCAGTAG", "ATCGTGCGTAGCAGTACGATCAGTAG")
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_gc(gr_seq, ambiguous = TRUE, variant = "Primer3Plus", Na = 50, mismatch = TRUE)
out
out$options
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.