Description Usage Arguments Details Value Author(s) References See Also Examples
Convert and Save sequence data frame to fasta file.
1 | dat2fasta(dat, outfile = "out.fasta")
|
dat |
data frame by |
outfile |
a character string, representing the name of the fasta file to be generated |
The column of the data frame must be: 1. seq.name, 2. seq.text, represent the name of the sequences, the content of the sequence, eg. ATCGGGAAC.
This is a routine without return value.
Jinlong Zhang <jinlongzhang01@gmail.com>
http://www.genomatix.de/online_help/help/sequence_formats.html
1 2 3 4 5 6 7 8 9 10 11 12 | cat(
">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.fasta", sep = "\n")
res <- read.fasta("trn1.fasta")
dat2fasta(res)
unlink("trn1.fasta")
unlink("out.fasta")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.