dat2phylip: Conver the data frame to sequential PHYLIP format file
In phylotools: Phylogenetic Tools for Eco-Phylogenetics

Description Usage Arguments Details Value Note Author(s) References See Also Examples

Convert and save a data frame to sequential PHYLIP file.

1	dat2phylip(dat, outfile = "out.phy")

`dat`	the data frame returned by `read.phylip`, `read.fasta`.
`outfile`	character string represents the phylip file to be generated.

The output will be in sequential PHYLIP format.

This is a subroutine, there is no return value.

The names of the sequences should not contain white space or Punctuation characters. See regex for more details.

Jinlong Zhang <jinlongzhang01@gmail.com>

http://www.genomatix.de/online_help/help/sequence_formats.html

dat2fasta, read.fasta, read.phylip

  cat(
  ">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
  ">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
  ">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
  ">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
  ">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
  file = "trn1.fasta", sep = "\n")

res <- read.fasta("trn1.fasta")
dat2phylip(res)
unlink("trn1.fasta")
unlink("out.phy")