read.phylip: read phylip file
In phylotools: Phylogenetic Tools for Eco-Phylogenetics

Description Usage Arguments Details Value Note Author(s) See Also Examples

read the phylip file, and store the sequences and their names in data frame.

1	read.phylip(infile, clean_name = TRUE)

`infile`	character string for the name of the phylip file.
`clean_name`	logical, representing cleaning of the names will be performed.

read.phylip accepts both interleaved and sequential phylip, the number of sequences is identified by parsing the first line of the file. Sequences and their names will be stored in a data frame.

If clean_name is TRUE, punctuation characters and white space be replaced by "_". Definition of punctuation characters can be found at regex.

a data frame with two columns: (1) seq.name, the names for all the sequences; (2) seq.text, the raw sequence data.

the Punctuation characters and white space in the names of the sequences will be replaced by "_".

Jinlong Zhang <jinlongzhang01@gmail.com>

read.fasta

  cat("6 22",
  "seq_1    --TTACAAATTGACTTATTATA",
  "seq_2    GATTACAAATTGACTTATTATA",
  "seq_3    GATTACAAATTGACTTATTATA",
  "seq_5    GATTACAAATTGACTTATTATA",
  "seq_8    GATTACAAATTGACTTATTATA",
  "seq_10   ---TACAAATTGAATTATTATA",
  file = "matk.phy", sep = "\n")

res <- read.phylip(infile = "matk.phy")
unlink("matk.phy")