Description Usage Arguments Value Note Author(s) References See Also Examples
get the names of all the sequences of a fasta file, and perform cleaning of the names of the sequences
1 | get.fasta.name(infile, clean_name = FALSE)
|
infile |
character string representing the name of the fasta file. |
clean_name |
logical, representing cleaning of the names will be performed. |
a character vector containing the names of the sequences
Punctuation characters and white space be replaced by "_". Definition of Punctuation characters can be found at regex.
Jinlong Zhang <jinlongzhang01@gmail.com>
http://www.genomatix.de/online_help/help/sequence_formats.html
1 2 3 4 5 6 7 8 9 | cat(
">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.fasta", sep = "\n")
get.fasta.name("trn1.fasta")
unlink("trn1.fasta")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.