read.fasta: Read FASTA file
In phylotools: Phylogenetic Tools for Eco-Phylogenetics

Description Usage Arguments Details Value Note Author(s) References See Also Examples

Read and convert the fasta file to data frame

1	read.fasta(file = NULL, clean_name = FALSE)

`file`	character string representing the name of the fasta file.
`clean_name`	logical, representing cleaning of the names will be performed. Punctuation characters and white space be replaced by "_" . See `regex` for more details.

In this function, names of the sequences are identified by ">", and all the lines before next ">" will be concatenated.

a data frame with two columns: (1) seq.name, the names for all the sequences. (2) seq.text, the raw sequence data.

Punctuation characters and white space in the names of the sequences will be replaced by "_".

Jinlong Zhang <jinlongzhang01@gmail.com>

http://www.genomatix.de/online_help/help/sequence_formats.html

read.phylip,dat2fasta,dat2phylip,split_dat

cat(
">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.fasta", sep = "\n")

res <- read.fasta("trn1.fasta")
unlink("trn1.fasta")