rename.fasta: Rename the sequences for a fasta file
In phylotools: Phylogenetic Tools for Eco-Phylogenetics

Description Usage Arguments Details Value Note Author(s) References See Also Examples

Rename the sequences within a fasta file according to a data frame supplied.

1	rename.fasta(infile = NULL, ref_table, outfile = "renamed.fasta")

`infile`	character string containing the name of the fasta file.
`ref_table`	a data frame with first column for original name, second column for the new name of the sequence.
`outfile`	The name of the fasta file with sequences renamed.

If the orginal name was not found in the ref_table, the name for the sequence will be changed into "old_name_" + orginal name.

This is a subroutine without return value.

Since whitespace and punctuation characters will be replaced with "_", name of a sequence might change. It is suggest to obtain the name of the sequences by calling read.fasta first, and save the data.frame to a csv file to obtain the "original" name for the sequences.

Jinlong Zhang <jinlongzhang01@gmail.com>

http://www.genomatix.de/online_help/help/sequence_formats.html

read.fasta, split_dat

cat(
    ">seq_1",  "--TTACAAATTGACTTATTATA",
    ">seq_2",  "GATTACAAATTGACTTATTATA",
    ">seq_3",  "GATTACAAATTGACTTATTATA",
    ">seq_5",  "GATTACAAATTGACTTATTATA",
    ">seq_8",  "GATTACAAATTGACTTATTATA",
    ">seq_10", "---TACAAATTGAATTATTATA",
    file = "matk.fasta", sep = "\n")
old_name <- get.fasta.name("matk.fasta")
new_name <- c("Magnolia", "Ranunculus", "Carex", "Morus", "Ulmus", "Salix")
ref2 <- data.frame(old_name, new_name)
rename.fasta(infile = "matk.fasta", ref_table = ref2, outfile = "renamed.fasta")
unlink("matk.fasta")
unlink("renamed.fasta")