rename.fasta: Rename the sequences for a fasta file

Description Usage Arguments Details Value Note Author(s) References See Also Examples

View source: R/rename.fasta.R

Description

Rename the sequences within a fasta file according to a data frame supplied.

Usage

1
rename.fasta(infile = NULL, ref_table, outfile = "renamed.fasta")

Arguments

infile

character string containing the name of the fasta file.

ref_table

a data frame with first column for original name, second column for the new name of the sequence.

outfile

The name of the fasta file with sequences renamed.

Details

If the orginal name was not found in the ref_table, the name for the sequence will be changed into "old_name_" + orginal name.

Value

This is a subroutine without return value.

Note

Since whitespace and punctuation characters will be replaced with "_", name of a sequence might change. It is suggest to obtain the name of the sequences by calling read.fasta first, and save the data.frame to a csv file to obtain the "original" name for the sequences.

Author(s)

Jinlong Zhang <[email protected]>

References

http://www.genomatix.de/online_help/help/sequence_formats.html

See Also

read.fasta, split_dat

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
cat(
    ">seq_1",  "--TTACAAATTGACTTATTATA",
    ">seq_2",  "GATTACAAATTGACTTATTATA",
    ">seq_3",  "GATTACAAATTGACTTATTATA",
    ">seq_5",  "GATTACAAATTGACTTATTATA",
    ">seq_8",  "GATTACAAATTGACTTATTATA",
    ">seq_10", "---TACAAATTGAATTATTATA",
    file = "matk.fasta", sep = "\n")
old_name <- get.fasta.name("matk.fasta")
new_name <- c("Magnolia", "Ranunculus", "Carex", "Morus", "Ulmus", "Salix")
ref2 <- data.frame(old_name, new_name)
rename.fasta(infile = "matk.fasta", ref_table = ref2, outfile = "renamed.fasta")
unlink("matk.fasta")
unlink("renamed.fasta")

phylotools documentation built on Dec. 10, 2017, 5:03 p.m.