#' UMI4C Contacts Processing
#'
#' Using demultiplexed FastQ files as input, performs all necessary steps to end
#' up with a tsv file summarizing the
#' restriction enzyme fragments and the number of UMIs supporting that specific
#' contact with the viewpoint (bait) of interest.
#'
#' @param fastq_dir Path of the directory containing the FastQ files (compressed
#' or uncompressed).
#' @param wk_dir Working directory where to save the outputs generated by the
#' UMI-4c analysis.
#' @param file_pattern Character that can be used to filter the files you want
#' to analyze in the \code{fastq_dir}.
#' @param bait_seq Character containing the bait primer sequence.
#' @param bait_pad Character containing the pad sequence (sequence between the
#' bait primer and the restriction enzyme sequence).
#' @param res_enz Character containing the restriction enzyme sequence.
#' @param cut_pos Numeric indicating the nucleotide position where restriction
#' enzyme cuts (zero-based) (for example, for DpnII is 0).
#' @param digested_genome Path for the digested genome file generated using the
#' \code{\link{digestGenome}} function.
#' @param ref_gen A BSgenome object of the reference genome.
#' @param sel_seqname A character with the chromosome name to focus the
#' search for the viewpoint sequence.
#' @param threads Number of threads to use in the analysis. Default=1.
#' @param numb_reads Number of lines from the FastQ file to load in each loop.
#' If having memory size problems, change it to a smaller number. Default=1e9.
#' @param rm_tmp Logical indicating whether to remove temporary files (sam and
#' intermediate bams). TRUE or FALSE. Default=TRUE.
#' @param min_flen Minimal fragment length to use for selecting the fragments.
#' Default=20
#' @param filter_bp Integer indicating the bp upstream and downstream of the
#' viewpoint to select for further analysis. Default=10e6
#' @param bowtie_index Path and prefix of the bowtie index to use for the
#' alignment.
#' @return This function is a combination of calls to other functions that
#' perform the necessary steps for processing
#' UMI-4C data.
#' @examples
#' if (interactive()) {
#' path <- downloadUMI4CexampleData()
#'
#' hg19_dpnii <- digestGenome(
#' cut_pos = 0,
#' res_enz = "GATC",
#' name_RE = "DpnII",
#' ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
#' out_path = file.path(path, "digested_genome")
#' )
#'
#'
#' raw_dir <- file.path(path, "CIITA", "fastq")
#'
#' contactsUMI4C(
#' fastq_dir = raw_dir,
#' wk_dir = file.path(path, "CIITA"),
#' bait_seq = "GGACAAGCTCCCTGCAACTCA",
#' bait_pad = "GGACTTGCA",
#' res_enz = "GATC",
#' cut_pos = 0,
#' digested_genome = hg19_dpnii,
#' bowtie_index = file.path(path, "ref_genome", "ucsc.hg19.chr16"),
#' threads = 1,
#' numb_reads = 1e9,
#' ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
#' sel_seqname = "chr16"
#' )
#'
#' unlink(path, recursive=TRUE)
#' }
#' @export
contactsUMI4C <- function(fastq_dir,
wk_dir,
file_pattern = NULL,
bait_seq,
bait_pad,
res_enz,
cut_pos,
digested_genome,
bowtie_index,
threads = 1,
numb_reads = 1e9,
rm_tmp = TRUE,
min_flen = 20,
filter_bp = 10e6,
ref_gen,
sel_seqname = NULL) {
dir.create(wk_dir, showWarnings = FALSE) # Create working dir
# cut_pos <- as.character(cut_pos) # convert to character
# get coordinates of viewpoint using biostrings
pos_viewpoint <- getViewpointCoordinates(
bait_seq = bait_seq,
bait_pad = bait_pad,
res_enz = res_enz,
ref_gen = ref_gen,
sel_seqname = sel_seqname
)
# Run steps of UMI4C analysis
prepUMI4C(
fastq_dir = fastq_dir,
wk_dir = wk_dir,
file_pattern = file_pattern,
bait_seq = bait_seq,
bait_pad = bait_pad,
res_enz = res_enz,
numb_reads = numb_reads
)
splitUMI4C(
wk_dir = wk_dir,
res_enz = res_enz,
cut_pos = cut_pos,
numb_reads = numb_reads,
min_flen = min_flen
)
alignmentUMI4C(
wk_dir = wk_dir,
pos_viewpoint = pos_viewpoint,
bowtie_index = bowtie_index,
threads = threads,
filter_bp = filter_bp
)
counterUMI4C(
wk_dir = wk_dir,
pos_viewpoint = pos_viewpoint,
res_enz = res_enz,
digested_genome = digested_genome,
filter_bp = filter_bp
)
# Remove unnecessary folders
if (rm_tmp) {
unlink(paste0(wk_dir, "/", c("align", "prep", "split")),
recursive = TRUE
)
}
}
#' Prepare UMI4C data
#'
#' Prepare the FastQ files for the further analysis by selecting reads with bait and
#' adding the respective UMI identifier for each read in its header.
#' @inheritParams contactsUMI4C
#' @return Creates a compressed FASTQ file in \code{wk_dir/prep} named
#' \code{basename(fastq)).fq.gz}, containing the filtered reads with the UMI
#' sequence in the header. A log file with the statistics is also generated
#' in \code{wk_dir/logs} named \code{umi4c_stats.txt}.
#' @examples
#' if (interactive()) {
#' path <- downloadUMI4CexampleData(reduced = TRUE)
#' raw_dir <- file.path(path, "CIITA", "fastq")
#'
#' prepUMI4C(
#' fastq_dir = raw_dir,
#' wk_dir = file.path(path, "CIITA"),
#' bait_seq = "GGACAAGCTCCCTGCAACTCA",
#' bait_pad = "GGACTTGCA",
#' res_enz = "GATC"
#' )
#' }
#' @seealso \code{\link{contactsUMI4C}}.
#' @export
prepUMI4C <- function(fastq_dir,
wk_dir,
file_pattern = NULL,
bait_seq,
bait_pad,
res_enz,
numb_reads = 1e9) {
message(paste(
paste0("\n[", Sys.time(), "]"),
"Starting prepUMI4C using:\n",
"> Fastq directory:\n", fastq_dir, "\n",
"> Work directory:", wk_dir, "\n",
"> Bait sequence:", bait_seq, "\n",
"> Bait pad:", bait_pad, "\n",
"> Restriction enzyme:", res_enz, "\n",
"> Number of reads loaded into memory:", numb_reads
))
# create directory
prep_dir <- file.path(wk_dir, "prep")
dir.create(prep_dir, showWarnings = FALSE)
# define variables
fastq_files <- list.files(fastq_dir,
pattern = "\\.fastq$|\\.fq$|\\.fq.gz$|\\.fastq.gz$",
full.names = TRUE
)
if (!is.null(file_pattern)) {
fastq_files <- fastq_files[grep(
file_pattern,
fastq_files
)]
}
if (length(fastq_files) < 2) stop(paste("Non paired-end FASTQ files with the extension _RX.fastq, _RX.fq, _RX.fq.gz
or _RX.fastq.gz in"), fastq_dir)
fastqR1_files <- fastq_files[grep("_R1", fastq_files)]
fastqR2_files <- fastq_files[grep("_R2", fastq_files)]
# apply main function to files
stats <- lapply(
seq_len(length(fastqR1_files)),
function(i) {
.singlePrepUMI4C(
fq_R1 = fastqR1_files[i],
fq_R2 = fastqR2_files[i],
bait_seq = bait_seq,
bait_pad = bait_pad,
res_enz = res_enz,
prep_dir = prep_dir,
numb_reads = numb_reads
)
}
)
# create stats file and save
stats <- do.call(rbind, stats)
dir.create(file.path(wk_dir, "logs"), showWarnings = FALSE) # Create logs dir
utils::write.table(stats,
file = file.path(wk_dir, "logs", "umi4c_stats.txt"),
row.names = FALSE,
sep = "\t",
quote = FALSE
)
}
#' Prepar fastq files at a given barcode.
#'
#' @param fq_R1 Fastq file R1.
#' @param fq_R2 Fastq file R2.
#' @param prep_dir Prep directory.
#' @inheritParams contactsUMI4C
#' @return Creates a compressed FASTQ file in \code{wk_dir/prep} named
#' \code{basename(Fastq)).fq.gz}, containing the filtered reads with the UMI
#' sequence in the header. A data.frame object with the statisitics is also
#' returned.
.singlePrepUMI4C <- function(fq_R1,
fq_R2,
bait_seq,
bait_pad,
res_enz,
prep_dir,
numb_reads = 1e9) {
stream1 <- ShortRead::FastqStreamer(fq_R1, n = numb_reads)
stream2 <- ShortRead::FastqStreamer(fq_R2, n = numb_reads)
# Check output fastq files
prep_fastqR1 <- paste0(gsub("\\..*", "", basename(fq_R1)), ".fq.gz")
prep_fastqR2 <- paste0(gsub("\\..*", "", basename(fq_R2)), ".fq.gz")
if (file.exists(file.path(prep_dir, prep_fastqR1))) unlink(file.path(prep_dir, prep_fastqR1))
if (file.exists(file.path(prep_dir, prep_fastqR2))) unlink(file.path(prep_dir, prep_fastqR2))
# Initialize global variables
total_reads <- 0
specific_reads <- 0
filtered_reads <- 0
# filter reads that not present bait seq + bait pad + re
barcode <- paste0(bait_seq, bait_pad, res_enz)
repeat {
reads_fqR1 <- ShortRead::yield(stream1)
reads_fqR2 <- ShortRead::yield(stream2)
if (length(reads_fqR1) == 0) break
if (length(reads_fqR1) != length(reads_fqR2)) stop("Different number of reads in R1 vs R2")
total_reads <- total_reads + length(reads_fqR1) # Save total reads
# for cases when the bait is to far from restriction enzyme
if (nchar(barcode) > unique(width(reads_fqR1))) {
barcode <- substr(barcode, 1, unique(width(reads_fqR1)))
}
barcode_reads_fqR1 <- reads_fqR1[grepl(barcode, ShortRead::sread(reads_fqR1))]
barcode_reads_fqR2 <- reads_fqR2[grepl(barcode, ShortRead::sread(reads_fqR1))]
specific_reads <- specific_reads + length(barcode_reads_fqR1) # Save specific reads
# filter reads with less than 20 phred score --------------------
filter20phred <- lapply(as(
Biostrings::PhredQuality(Biostrings::quality(barcode_reads_fqR1)),
"IntegerList"
), mean) >= 20 &
lapply(as(Biostrings::PhredQuality(Biostrings::quality(barcode_reads_fqR2)), "IntegerList"), mean) >= 20
filtered_reads_fqR1 <- ShortRead::ShortReadQ(
ShortRead::sread(barcode_reads_fqR1)[filter20phred],
Biostrings::quality(barcode_reads_fqR1)[filter20phred],
ShortRead::id(barcode_reads_fqR1)[filter20phred]
)
filtered_reads_fqR2 <- ShortRead::ShortReadQ(
ShortRead::sread(barcode_reads_fqR2)[filter20phred],
Biostrings::quality(barcode_reads_fqR2)[filter20phred],
ShortRead::id(barcode_reads_fqR2)[filter20phred]
)
# insert umi identifier (10 first bp of R2) to header of both R1 R2 files -----------
umis <- stringr::str_sub(as.character(ShortRead::sread(filtered_reads_fqR2)), start = 1, end = 10)
new_id_R1 <- paste0(umis, ":", "UMI4C:", seq(filtered_reads + 1, filtered_reads + length(filtered_reads_fqR1)), ":R1")
new_id_R2 <- paste0(umis, ":", "UMI4C:", seq(filtered_reads + 1, filtered_reads + length(filtered_reads_fqR2)), ":R2")
filtered_reads <- filtered_reads + length(filtered_reads_fqR1) # Return num filtered reads
umi_reads_fqR1 <- ShortRead::ShortReadQ(
ShortRead::sread(filtered_reads_fqR1),
Biostrings::quality(filtered_reads_fqR1),
Biostrings::BStringSet(new_id_R1)
)
umi_reads_fqR2 <- ShortRead::ShortReadQ(
ShortRead::sread(filtered_reads_fqR2),
Biostrings::quality(filtered_reads_fqR2),
Biostrings::BStringSet(new_id_R2)
)
# write output fastq files
ShortRead::writeFastq(umi_reads_fqR1,
file.path(prep_dir, prep_fastqR1),
mode = "a"
)
ShortRead::writeFastq(umi_reads_fqR2,
file.path(prep_dir, prep_fastqR2),
mode = "a"
)
}
message(
paste0("[", Sys.time(), "] "),
"Finished sample ", strsplit(basename(fq_R1), "_R.")[[1]][1]
)
on.exit(close(stream1))
on.exit(close(stream2), add = TRUE)
# Construct stats data.frame
stats <- data.frame(
sample_id = strsplit(basename(fq_R1), "_R1")[[1]][1],
total_reads = total_reads,
specific_reads = specific_reads,
filtered_reads = filtered_reads,
stringsAsFactors = FALSE
)
return(stats)
}
#' Split UMI4C reads
#'
#' Split the prepared reads using the restrition enzyme information.
#' @inheritParams contactsUMI4C
#' @return Creates a compressed FASTQ file in \code{wk_dir/split} named
#' \code{basename(fastq)).fq.gz}, containing the
#' split reads based on the restriction enzyme used.
#' @examples
#' if (interactive()) {
#' path <- downloadUMI4CexampleData(reduced = TRUE)
#'
#' splitUMI4C(
#' wk_dir = file.path(path, "CIITA"),
#' res_enz = "GATC",
#' cut_pos = 0
#' )
#' }
#' @export
splitUMI4C <- function(wk_dir,
res_enz,
cut_pos,
numb_reads = 1e9,
min_flen = 20) {
message(paste(
paste0("\n[", Sys.time(), "]"),
"Starting splitUMI4C using:\n",
"> Work directory:", wk_dir, "\n",
"> Cut position:", cut_pos, "\n",
"> Restriction enzyme:", res_enz, "\n",
"> Number of reads loaded into memory:", numb_reads
))
# create directory
prep_dir <- file.path(wk_dir, "prep")
split_dir <- file.path(wk_dir, "split")
dir.create(split_dir, showWarnings = FALSE)
prep_files <- list.files(prep_dir,
pattern = ".gz$",
full.names = TRUE
)
if (length(prep_files) < 2) stop(paste("Non paired-end prep FASTQ files with the extension _RX.fastq.gz
or _RX.fq.gz in"), prep_dir)
prep_files_R1 <- prep_files[grep("_R1", prep_files)]
prep_files_R2 <- prep_files[grep("_R2", prep_files)]
# run main function
lapply(prep_files_R1, .singleSplitUMI4C,
res_enz = res_enz, cut_pos = cut_pos, split_dir = split_dir,
numb_reads = numb_reads
)
# run main function
lapply(prep_files_R2, .singleSplitUMI4C,
res_enz = res_enz, cut_pos = (nchar(res_enz) - cut_pos), split_dir = split_dir,
numb_reads = numb_reads
)
}
#' Split fastq files at a given restriction site.
#' @param fastq_file Fastq file path.
#' @param split_dir Directory where to save split files.
#' @inheritParams contactsUMI4C
#' @return Creates a compressed FASTQ file in \code{wk_dir/split} named
#' \code{basename(fastq)).fq.gz}, containing the split reads based on the
#' restriction enzyme used.
.singleSplitUMI4C <- function(fastq_file,
res_enz,
cut_pos,
split_dir,
min_flen = 20,
numb_reads = 1e9) {
# Use stream
stream <- ShortRead::FastqStreamer(fastq_file, n = numb_reads)
on.exit(close(stream))
# Remove file if already exists
split_fastq_name <- paste0(
gsub("\\..*$", "", basename(fastq_file)),
".fq.gz"
)
filename <- file.path(split_dir, split_fastq_name)
# Remove file if it already exists to avoid appending new reads
if (file.exists(filename)) unlink(filename)
repeat {
# define variables and create objects
prep_reads <- ShortRead::yield(stream)
if (length(prep_reads) == 0) break
prep_dna_string <- ShortRead::sread(prep_reads)
ids <- ShortRead::id(prep_reads)
# Find matches for the re sequence
matches <- Biostrings::vmatchPattern(res_enz, prep_dna_string)
matches <- as(matches, "CompressedIRangesList")
IRanges::start(matches) <- as(
IRanges::start(matches) - 1,
"CompressedIntegerList"
)
IRanges::end(matches) <- as(
IRanges::end(matches) - (nchar(res_enz) - cut_pos),
"CompressedIntegerList"
)
# workaround for obtaining the cut position
gaps <- IRanges::gaps(matches,
start = 1,
end = unique(nchar(as.character(prep_dna_string)))
)
ids_sel <- gaps
IRanges::start(ids_sel) <- as(1, "IntegerList")
IRanges::end(ids_sel) <- as(nchar(as.character(ids)), "IntegerList")
list_seqs <- Biostrings::extractAt(prep_dna_string, gaps)
list_quals <- Biostrings::extractAt(Biostrings::quality(Biostrings::quality(prep_reads)), gaps)
list_ids <- Biostrings::extractAt(ids, ids_sel)
fastq_entry <- ShortRead::ShortReadQ()
fastq_entry@sread <- unlist(list_seqs)
fastq_entry@quality <- ShortRead::FastqQuality(unlist(list_quals))
fastq_entry@id <- unlist(list_ids)
# Remove reads shorter than minimum fragment length
fastq_entry <- fastq_entry[ShortRead::width(fastq_entry) >= min_flen]
ShortRead::writeFastq(fastq_entry,
file = filename,
mode = "a"
)
}
message(
paste0("[", Sys.time(), "] "),
"Finished sample ", basename(fastq_file)
)
}
#' UMI4C alignment
#'
#' Align split UMI-4C reads to a reference genome using Bowtie2.
#' @inheritParams contactsUMI4C
#' @param pos_viewpoint GRanges object containing the genomic position of the
#' viewpoint. It can be generated by \code{getViewpointCoordinates} function.
#' @return Creates a BAM file in \code{wk_dir/align} named
#' "\code{basename(fastq))_filtered.bam}", containing the
#' aligned filtered reads. The alignment log is also generated in
#' \code{wk_dir/logs} named "\code{umi4c_alignment_stats.txt}".
#' @examples
#' if (interactive()){
#' path <- downloadUMI4CexampleData(reduced = TRUE)
#' alignmentUMI4C(
#' wk_dir = file.path(path, "CIITA"),
#' pos_viewpoint = GenomicRanges::GRanges("chr16:10972515-10972548"),
#' bowtie_index = file.path(path, "ref_genome", "ucsc.hg19.chr16")
#' )
#' }
#' @export
alignmentUMI4C <- function(wk_dir,
pos_viewpoint,
bowtie_index,
threads = 1,
filter_bp = 10e6) {
message(paste(
paste0("\n[", Sys.time(), "]"),
"Starting alignmentUMI4C using:\n",
"> Work directory:", wk_dir, "\n",
"> Viewpoint position:", paste0(
as.character(GenomeInfoDb::seqnames(pos_viewpoint)),
":",
as.character(IRanges::ranges(pos_viewpoint))
), "\n",
"> Reference genome:", bowtie_index, "\n",
"> Number of threads:", threads
))
if (length(pos_viewpoint) == 0) stop(paste("Define viewpoint position"))
# align split files
split_dir <- file.path(wk_dir, "split")
align_dir <- file.path(wk_dir, "align")
dir.create(align_dir, showWarnings = FALSE)
gz_files <- list.files(split_dir,
pattern = ".gz$",
full.names = TRUE
)
if (length(gz_files) != 0) {
lapply(gz_files, R.utils::gunzip, overwrite = TRUE)
}
split_files <- list.files(split_dir,
pattern = "\\.fastq$|\\.fq$",
full.names = TRUE
)
if (length(split_files) < 2) {
stop(
paste("No paired-end split FASTQ files with the extension _RX.fastq.gz
,_RX.fq.gz, _RX.fastq or _RX.fq in"),
split_dir
)
}
stats <- lapply(split_files,
.singleAlignmentUMI4C,
align_dir = align_dir,
threads = threads,
bowtie_index = bowtie_index,
pos_viewpoint = pos_viewpoint
)
stats <- do.call(rbind, stats)
utils::write.table(stats,
file = file.path(wk_dir, "logs", "umi4c_alignment_stats.txt"),
row.names = FALSE, sep = "\t", quote = FALSE
)
}
#' Align split fastq file
#' @inheritParams contactsUMI4C
#' @param split_file Split fastq file to align.
#' @param align_dir Directory where to save aligned files.
#' @param pos_viewpoint GRanges object containing the genomic position of the
#' viewpoint.
#' @return Creates a BAM file in \code{wk_dir/align} named
#' "\code{basename(fastq))_filtered.bam}", containing the aligned filtered
#' reads. A data.frame object with the statisitics is also returned.
#' @inheritParams contactsUMI4C
.singleAlignmentUMI4C <- function(split_file,
align_dir,
threads = 1,
bowtie_index,
pos_viewpoint,
filter_bp = 10e6) {
split_name <- gsub("\\..*$", "", basename(split_file))
sam <- file.path(align_dir, paste0(split_name, ".sam"))
bam <- file.path(align_dir, paste0(split_name, ".bam"))
filtered_tmp_bam <- file.path(align_dir, paste0(
split_name,
"_filtered_tmp.bam"
))
filtered_bam <- file.path(align_dir, paste0(split_name, "_filtered.bam"))
# TODO:create bowtie2 index if it does not exist
# align using bowtie2
suppressMessages(Rbowtie2::bowtie2(
seq1 = split_file,
bt2Index = bowtie_index,
"--threads", threads,
samOutput = sam,
overwrite = TRUE
))
# sam to bam
Rsamtools::asBam(sam, overwrite = TRUE)
# keep reads in a 10M window from viewpoint
pos_filter <- GenomicRanges::resize(pos_viewpoint,
fix = "center",
width = filter_bp * 2
)
param_10M <- Rsamtools::ScanBamParam(which = pos_filter)
Rsamtools::filterBam(bam, filtered_tmp_bam, param = param_10M)
# filter reads with 42mapq at least
filter_mapq <- S4Vectors::FilterRules(list(mapq_filter = function(x) x$mapq >= 30))
Rsamtools::filterBam(filtered_tmp_bam,
filtered_bam,
filter = filter_mapq,
param = Rsamtools::ScanBamParam(what = "mapq")
)
message(
paste0("[", Sys.time(), "] "),
"Finished sample ", basename(split_file)
)
# Obtain stats for alignment
stats <- data.frame(
sample_id = gsub(".sam", "", basename(sam)),
al_mapped = .getSummaryBam(gsub(".sam", ".bam", sam),
mapped = TRUE
),
al_unmapped = .getSummaryBam(gsub(".sam", ".bam", sam),
mapped = FALSE
),
al_secondary = .getSummaryBam(gsub(".sam", ".bam", sam),
mapped = TRUE, secondary = TRUE
)
)
return(stats)
}
#' UMI counting
#'
#' Algorithm for counting and collapsing the number of UMIs supporting a
#' specific ligation.
#' @inheritParams contactsUMI4C
#' @param pos_viewpoint GRanges object containing the genomic position of the
#' viewpoint.
#' @param filter_bp Integer indicating the bp upstream and downstream of the
#' viewpoint to select for further analysis. Default=10e6.
#' @return Creates a compressed tab-delimited file in \code{wk_dir/count} named
#' "\code{basename(fastq) _counts.tsv.gz}", containing the
#' coordinates for the viewpoint fragment, contact fragment and the number of
#' UMIs detected in the ligation.
#' @examples
#' if (interactive()) {
#' path <- downloadUMI4CexampleData(reduced = TRUE)
#'
#' hg19_dpnii <- digestGenome(
#' cut_pos = 0,
#' res_enz = "GATC",
#' name_RE = "DpnII",
#' sel_chr = "chr16", # digest only chr16 to make example faster
#' ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
#' out_path = file.path(path, "digested_genome")
#' )
#'
#' viewpoint <- GenomicRanges::GRanges("chr16:10972515-10972548")
#'
#' counterUMI4C(
#' wk_dir = file.path(path, "CIITA"),
#' pos_viewpoint = viewpoint,
#' res_enz = "GATC",
#' digested_genome = hg19_dpnii
#' )
#'
#' }
#' @details For collapsing different molecules into the same UMI, takes into
#' account the ligation position and the number of UMI sequence mismatches.
#' @export
counterUMI4C <- function(wk_dir,
pos_viewpoint,
res_enz,
digested_genome,
filter_bp = 10e6) {
message(paste(
paste0("\n[", Sys.time(), "]"),
"Starting counterUMI4C using:\n",
"> Work directory:", wk_dir, "\n",
"> Viewpoint position:", paste0(
as.character(GenomeInfoDb::seqnames(pos_viewpoint)),
":",
as.character(IRanges::ranges(pos_viewpoint))
), "\n",
"> Restriction enzyme:", res_enz, "\n",
"> Digested genome:", digested_genome
))
if (!exists("pos_viewpoint")) stop(paste("Define viewpoint position"))
align_dir <- file.path(wk_dir, "align")
count_dir <- file.path(wk_dir, "count")
dir.create(count_dir, showWarnings = FALSE)
# define variables
aligned_files <- list.files(align_dir,
pattern = "_filtered.bam$",
full.names = TRUE
)
if (length(aligned_files) < 2) {
stop(paste(
"Non aligned BAM files with the extension _filtered.bam in",
align_dir
))
}
alignedR1_files <- aligned_files[grep("_R1", aligned_files)]
alignedR2_files <- aligned_files[grep("_R2", aligned_files)]
# Load digested genome
file <- list.files(digested_genome,
pattern = paste0(as.character(GenomicRanges::seqnames(pos_viewpoint)), ".rda"),
full.names = TRUE
)
if (length(file) == 0) stop(paste("No digested genome file"))
digested_genome_gr <- NULL # Avoid no visible binding for global variable
load(file)
nll <- lapply(
seq_len(length(alignedR1_files)),
function(i) {
.singleCounterUMI4C(
filtered_bam_R1 = alignedR1_files[i],
filtered_bam_R2 = alignedR2_files[i],
digested_genome_gr = digested_genome_gr,
pos_viewpoint = pos_viewpoint,
res_enz = res_enz,
count_dir = count_dir,
filter_bp = filter_bp
)
}
)
}
#' Count UMIs for a given bam file.
#' @param filtered_bam_R1 R1 bam file.
#' @param filtered_bam_R2 R2 bam file.
#' @param digested_genome_gr GRanges object containing the coordinates for the
#' digested genome.
#' @param pos_viewpoint Vector consist of chromosome, start and end position of
#' the viewpoint.
#' @param count_dir Counter directory.
#' @return Creates a tab-delimited file in \code{wk_dir/count} named
#' "\code{basename(fastq) _counts.tsv}", containing the
#' coordinates for the viewpoint fragment, contact fragment and the number of
#' UMIs detected in the ligation.
#' @inheritParams contactsUMI4C
.singleCounterUMI4C <- function(filtered_bam_R1,
filtered_bam_R2,
digested_genome_gr,
pos_viewpoint,
res_enz,
count_dir,
filter_bp = 10e6) {
viewpoint_filter <- GenomicRanges::resize(pos_viewpoint,
width = filter_bp * 2,
fix = "center"
)
# load digest genome, filter and transform to granges
digested_genome_gr <- IRanges::subsetByOverlaps(
digested_genome_gr,
viewpoint_filter
)
# read bam and transform to a granges
bam_R1_gr <- GenomicAlignments::readGAlignments(filtered_bam_R1,
use.names = TRUE,
param = Rsamtools::ScanBamParam(which = viewpoint_filter)
)
bam_R2_gr <- GenomicAlignments::readGAlignments(filtered_bam_R2,
use.names = TRUE,
param = Rsamtools::ScanBamParam(which = viewpoint_filter)
)
mcols(bam_R1_gr)$header <- names(bam_R1_gr)
mcols(bam_R1_gr)$umi <- vapply(
strsplit(names(bam_R1_gr), ":"),
function(x) x[1],
FUN.VALUE = character(1)
)
mcols(bam_R1_gr)$readID <- vapply(
strsplit(names(bam_R1_gr), ":"),
function(x) paste0(x[2], "_", x[3]),
FUN.VALUE = character(1)
)
mcols(bam_R2_gr)$header <- names(bam_R2_gr)
mcols(bam_R2_gr)$umi <- vapply(
strsplit(names(bam_R2_gr), ":"),
function(x) x[1],
FUN.VALUE = character(1)
)
mcols(bam_R2_gr)$readID <- vapply(
strsplit(names(bam_R2_gr), ":"),
function(x) paste0(x[2], "_", x[3]),
FUN.VALUE = character(1)
)
gr1 <- GenomicAlignments::granges(bam_R1_gr, use.mcols = TRUE, use.names = FALSE)
gr2 <- GenomicAlignments::granges(bam_R2_gr, use.mcols = TRUE, use.names = FALSE)
gr <- c(gr1, gr2)
gr_sp <- GenomicRanges::GRangesList(GenomicRanges::split(gr, gr$readID))
n <- elementNROWS(gr_sp)
## Regions containing only the viewpoint
uni <- unlist(gr_sp[n == 1])
uni <- regioneR::joinRegions(uni)
ligations <- gr_sp[n > 1]
ligations_noview <- IRanges::subsetByOverlaps(unlist(ligations), uni,
invert = TRUE
)
lig_noview_unl <- GenomicRanges::GRangesList(GenomicRanges::split(
ligations_noview,
ligations_noview$readID
))
## Select representatives from each ligation
reps <- unlist(lig_noview_unl[end(lig_noview_unl) == max(end(lig_noview_unl))])
dup_positions <- duplicated(start(reps)) & duplicated(end(reps))
reps_pos <- reps[!dup_positions]
## Compare UMIs
collapsed_umis <- c()
umi_list <- unique(Biostrings::DNAStringSet(reps_pos$umi))
while (length(umi_list) > 0) {
compared_umi <- umi_list[[1]]
collapsed_umis <- c(collapsed_umis, as.character(compared_umi))
matches <- Biostrings::vcountPattern(compared_umi, umi_list, max.mismatch = 2)
umi_list <- umi_list[!as.logical(matches)]
}
reps_pos_umis <- reps_pos[reps_pos$umi %in% collapsed_umis]
# Select unique ligations
final_ligations <- unlist(ligations[names(ligations) %in% unique(reps_pos_umis$readID)])
# Compare each range with fragment id for each ligation
hits <- findOverlaps(final_ligations,
digested_genome_gr,
minoverlap = nchar(res_enz) + 1
)
final <- final_ligations[queryHits(hits)]
final$fragID <- as.character(mcols(digested_genome_gr)[subjectHits(hits), 1])
table <- as.data.frame(table(final$fragID))
umis_df <- data.frame(digested_genome_gr)[, c(1, 2, 3, 6)]
umis_df <- suppressWarnings(dplyr::left_join(umis_df, table, by = c(id = "Var1")))
viewpoint <- data.frame(subsetByOverlaps(digested_genome_gr, pos_viewpoint))[, c(1, 2, 3)]
final_umis <- cbind(
viewpoint[rep(1, nrow(umis_df)), ],
umis_df[, -4]
)
colnames(final_umis) <- c(
"chr_bait", "start_bait", 'end_bait',
"chr_contact", "start_contact", 'end_contact',
"UMIs"
)
final_umis$UMIs[is.na(final_umis$UMIs)] <- 0
file_name <- strsplit(basename(filtered_bam_R1), "_R1")[[1]][1]
counts_file <- file.path(count_dir, paste0(file_name, "_counts.tsv"))
utils::write.table(
x = final_umis,
file = counts_file,
row.names = FALSE,
quote = FALSE,
sep = "\t"
)
R.utils::gzip(counts_file, overwrite = TRUE)
message(
paste0("[", Sys.time(), "] "),
"Finished sample ", file_name
)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.