utils-sequence: Sequence-related utility functions.
In universalmotif: Import, Modify, and Export Motifs with R

Description Usage Arguments Value Author(s) See Also Examples

Sequence-related utility functions.

count_klets(string, k = 1, alph)

get_klets(lets, k = 1)

mask_seqs(seqs, pattern, RC = FALSE, letter = "-")

shuffle_string(string, k = 1, method = c("euler", "linear", "markov"),
  rng.seed = sample.int(10000, 1))

`string`	`character(1)` A length one character vector.
`k`	`integer(1)` K-let size.
`alph`	`character(1)` A single character string with the desired sequence alphabet. If missing, finds the unique letters in the string.
`lets`	`character` A character vector where each element will be considered a single unit.
`seqs`	`XStringSet` Sequences to mask. Cannot be `BStringSet`.
`pattern`	`character(1)` Pattern to mask.
`RC`	`logical(1)` Whether to mask the reverse complement of the pattern.
`letter`	`character(1)` Character to use for masking.
`method`	`character(1)` Shuffling method. One of `c("euler", "linear", "markov")`. See `shuffle_sequences()`.
`rng.seed`	`numeric(1)` Set random number generator seed. Since shuffling in `shuffle_sequences()` can occur simultaneously in multiple threads using C++, it cannot communicate with the regular `R` random number generator state and thus requires an independent seed. Since `shuffle_string()` uses the same underlying code as `shuffle_sequences()`, it also requires a separate seed even if it is run in serial.

For count_klets(): A data.frame with columns lets and counts.

For get_klets(): A character vector of k-lets.

For mask_seqs(): The masked XStringSet object.

For shuffle_string(): A single character string.

Benjamin Jean-Marie Tremblay, b2tremblay@uwaterloo.ca

create_sequences(), shuffle_sequences()

#######################################################################
## count_klets
## Count k-lets for any string of characters
count_klets("GCAAATGTACGCAGGGCCGA", k = 2)
## The default 'k' value (1) counts individual letters
count_klets("GCAAATGTACGCAGGGCCGA")

#######################################################################
## get_klets
## Generate all possible k-lets for a set of characters
get_klets(c("A", "C", "G", "T"), 3)
## Note that each element in 'lets' is considered a single unit;
## see:
get_klets(c("AA", "B"), k = 2)

#######################################################################
## mask_seqs
## Mask repetitive seqeuences
data(ArabidopsisPromoters)
mask_seqs(ArabidopsisPromoters, "AAAAAA")

#######################################################################
## shuffle_string
## Shuffle any string of characters
shuffle_string("ASDADASDASDASD", k = 2)