if (getRversion() >= "2.15.1") {
utils::globalVariables(".")
}
################################################################################
#' Add dna in `refseq` slot of a `physeq` object using taxa names and renames taxa
#' using ASV_1, ASV_2, …
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-stable-green" alt="lifecycle-stable"></a>
#'
#' Useful in targets bioinformatic pipeline.
#'
#' @inheritParams clean_pq
#'
#' @return A new \code{\link{phyloseq-class}} object with `refseq` slot and new
#' taxa names
#' @export
add_dna_to_phyloseq <- function(physeq) {
verify_pq(physeq)
dna <- Biostrings::DNAStringSet(phyloseq::taxa_names(physeq))
names(dna) <- phyloseq::taxa_names(physeq)
physeq <- phyloseq::merge_phyloseq(physeq, dna)
phyloseq::taxa_names(physeq) <-
paste0("ASV_", seq(phyloseq::ntaxa(physeq)))
return(physeq)
}
################################################################################
################################################################################
#' Clean phyloseq object by removing empty samples and taxa
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' In addition, this function check for discrepancy (and rename) between
#' (i) taxa names in refseq, taxonomy table and otu_table and between
#' (ii) sample names in sam_data and otu_table.
#'
#' @param physeq (required): a \code{\link{phyloseq-class}} object obtained
#' using the `phyloseq` package.
#' @param remove_empty_samples (logical) Do you want to remove samples
#' without sequences (this is done after removing empty taxa)
#' @param remove_empty_taxa (logical) Do you want to remove taxa
#' without sequences (this is done before removing empty samples)
#' @param clean_samples_names (logical) Do you want to clean samples names?
#' @param silent (logical) If true, no message are printing.
#' @param verbose (logical) Additional informations in the message
#' the verbose parameter overwrite the silent parameter.
#' @param force_taxa_as_columns (logical) If true, if the taxa are rows
#' transpose the otu_table and set taxa_are_rows to false
#' @param force_taxa_as_rows (logical) If true, if the taxa are columns
#' transpose the otu_table and set taxa_are_rows to true
#' @param reorder_asv (logical) if TRUE the otu_table is ordered by the number of
#' sequences of ASV (descending order). Default to FALSE.
#' @param rename_asv (logical) if TRUE, ASV are renamed by their position
#' in the OTU_table (asv_1, asv_2, ...). Default to FALSE. If rename ASV is true,
#' the ASV names in verbose information can be misleading.
#' @param simplify_taxo (logical) if TRUE, correct the taxonomy_table using the
#' `MiscMetabar::simplify_taxo()` function
#' @return A new \code{\link{phyloseq-class}} object
#' @export
clean_pq <- function(physeq,
remove_empty_samples = TRUE,
remove_empty_taxa = TRUE,
clean_samples_names = TRUE,
silent = FALSE,
verbose = FALSE,
force_taxa_as_columns = FALSE,
force_taxa_as_rows = FALSE,
reorder_asv = FALSE,
rename_asv = FALSE,
simplify_taxo = FALSE) {
if (clean_samples_names) {
if (!is.null(physeq@refseq)) {
if (sum(!names(physeq@refseq) %in% taxa_names(physeq)) > 0) {
names(physeq@refseq) <- taxa_names(physeq)
if (!silent) {
message("Change the samples names in refseq slot")
}
}
}
if (!is.null(physeq@tax_table)) {
if (sum(!rownames(physeq@tax_table) %in% taxa_names(physeq)) > 0) {
rownames(physeq@tax_table) <- taxa_names(physeq)
if (!silent) {
message("Change the taxa names in tax_table slot")
}
}
}
if (!is.null(physeq@sam_data)) {
if (sum(!rownames(physeq@sam_data) %in% sample_names(physeq)) > 0) {
rownames(physeq@sam_data) <- sample_names(physeq)
if (!silent) {
message("Change the samples names in sam_data slot")
}
}
}
}
verify_pq(physeq)
if (reorder_asv) {
physeq <- reorder_taxa_pq(
physeq,
taxa_names(physeq)[order(taxa_sums(physeq), decreasing = TRUE)]
)
}
if (rename_asv) {
taxa_names(physeq) <- paste0("ASV_", seq(1, ntaxa(physeq)))
}
if (sum(grepl("^0", sample_names(physeq)) > 0) && !silent) {
message(
"At least one sample name start with a zero.
That can be a problem for some phyloseq functions such as
plot_bar and psmelt."
)
}
if (force_taxa_as_columns && force_taxa_as_rows) {
stop("You can't force taxa as column and taxa as row in the same time.")
}
if (force_taxa_as_columns && taxa_are_rows(physeq)) {
otu_table(physeq) <-
otu_table(
t(as.matrix(unclass(
physeq@otu_table
))),
taxa_are_rows = FALSE
)
message("Taxa are now in columns.")
}
if (force_taxa_as_rows && !taxa_are_rows(physeq)) {
otu_table(physeq) <-
otu_table(
t(as.matrix(unclass(
physeq@otu_table
))),
taxa_are_rows = TRUE
)
message("Taxa are now in rows.")
}
if (simplify_taxo) {
physeq <- simplify_taxo(physeq)
}
new_physeq <- physeq
if (remove_empty_taxa) {
if (sum(taxa_sums(new_physeq) != 0) > 0) {
new_physeq <- subset_taxa(physeq, taxa_sums(physeq) > 0)
}
}
if (remove_empty_samples) {
if (sum(sample_sums(new_physeq) != 0) > 0) {
new_physeq <- subset_samples(new_physeq, sample_sums(physeq) > 0)
}
}
if (verbose) {
message(
paste(
"Cleaning suppress",
ntaxa(physeq) - ntaxa(new_physeq),
"taxa (",
paste(taxa_names(physeq)[taxa_sums(physeq) == 0], collapse = " / "),
") and",
nsamples(physeq) - nsamples(new_physeq),
"sample(s) (",
paste(sample_names(physeq)[sample_sums(physeq) == 0], collapse = " / "),
")."
)
)
} else if (!silent) {
message(
paste(
"Cleaning suppress",
ntaxa(physeq) - ntaxa(new_physeq),
"taxa and",
nsamples(physeq) - nsamples(new_physeq),
"samples."
)
)
}
verify_pq(new_physeq)
return(new_physeq)
}
################################################################################
#' Track the number of reads (= sequences), samples and cluster (e.g. ASV)
#' from various objects including dada-class and derep-class.
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' * List of fastq and fastg.gz files -> nb of reads and samples
#' * List of dada-class -> nb of reads, clusters (ASV) and samples
#' * List of derep-class -> nb of reads, clusters (unique sequences)
#' and samples
#' * Matrix of samples x clusters (e.g. `otu_table`) -> nb of reads,
#' clusters and samples
#' * Phyloseq-class -> nb of reads, clusters and samples
#'
#' @param list_of_objects (required) a list of objects
#' @param obj_names
#' A list of names corresponding to the list of objects
#' @param clean_pq (logical)
#' If set to TRUE, empty samples and empty ASV are discarded
#' before clustering.
#' @param taxonomy_rank A vector of int. Define the column number of
#' taxonomic rank `in physeq@tax_table` to compute the number of unique value.
#' Default is NULL and do not compute values for any taxonomic rank
#' @param ... Other arguments passed on to [clean_pq()] function.
#'
#' @return The number of sequences, clusters (e.g. OTUs, ASVs) and samples for
#' each object.
#' @export
#' @seealso [track_wkflow_samples()]
#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"
#' data(enterotype)
#' if (requireNamespace("pbapply")) {
#' track_wkflow(list(data_fungi, enterotype), taxonomy_rank = c(3, 5))
#' }
track_wkflow <- function(list_of_objects,
obj_names = NULL,
clean_pq = FALSE,
taxonomy_rank = NULL,
...) {
message("Compute the number of sequences")
if (!is.null(obj_names)) {
names(list_of_objects) <- obj_names
}
if (clean_pq) {
for (i in seq_along(list_of_objects)) {
if (inherits(list_of_objects[[i]], "phyloseq")) {
list_of_objects[[i]] <- clean_pq(list_of_objects[[i]], ...)
}
}
}
track_nb_seq_per_obj <-
pbapply::pblapply(list_of_objects, function(object) {
message(paste("Start object of class:", class(object), sep = " "))
if (inherits(object, "phyloseq")) {
sum(object@otu_table)
} else if (inherits(object, "matrix")) {
sum(object, na.rm = TRUE)
} else if (is.character(object[1]) &&
length(object[1]) == 1 &&
file.exists(object[1])) {
if (summary(file(object[[1]]))$class == "gzfile") {
pbapply::pbsapply(object, function(x) {
as.numeric(system(paste("zcat ", x, " | grep -c '^+$'", sep = ""),
intern = TRUE
))
})
} else if (grepl("\\.fastq$", object[1])) {
pbapply::pbsapply(object, function(x) {
as.numeric(system(paste("cat ", x, " | grep -c '^+$'", sep = ""),
intern = TRUE
))
})
} else {
stop("Files must be either gzfile or .fastq")
}
} else if (inherits(object, "derep")) {
sum(object$uniques)
} else if (inherits(object, "dada")) {
sum(dada2::getUniques(object))
} else {
pbapply::pbsapply(object, function(x) {
sum(dada2::getUniques(x, silence = TRUE))
})
}
})
track_nb_seq_per_obj <-
pbapply::pblapply(track_nb_seq_per_obj, sum)
message("Compute the number of clusters")
track_nb_cluster_per_obj <-
pbapply::pblapply(list_of_objects, function(object) {
message(paste("Start object of class:", class(object), sep = " "))
if (inherits(object, "phyloseq")) {
ntaxa(object)
} else if (inherits(object, "matrix")) {
ncol(object)
} else if (inherits(object, "dada")) {
length(object$sequence)
} else if (inherits(object[[1]], "dada")) {
dim(suppressMessages(dada2::makeSequenceTable(object)))[2]
} else if (is.data.frame(object[[1]]) &&
all(c("sequence", "abundance") %in% colnames(object[[1]]))) {
dim(suppressMessages(dada2::makeSequenceTable(object)))[2]
} else if (inherits(object, "derep")) {
length(unique(names(object$uniques)))
} else if (inherits(object[[1]], "derep")) {
length(unique(unlist(lapply(object, function(x) {
names(x$uniques)
}))))
} else {
NA
}
})
message("Compute the number of samples")
track_nb_sam_per_obj <-
pbapply::pblapply(list_of_objects, function(object) {
message(paste("Start object of class:", class(object), sep = " "))
if (inherits(object, "phyloseq")) {
nsamples(object)
} else if (inherits(object, "matrix")) {
nrow(object)
} else if (inherits(object, "dada")) {
1
} else if (inherits(object[[1]], "dada")) {
dim(suppressMessages(dada2::makeSequenceTable(object)))[1]
} else if (is.data.frame(object[[1]]) &&
all(c("sequence", "abundance") %in% colnames(object[[1]]))) {
dim(suppressMessages(dada2::makeSequenceTable(object)))[1]
} else if (inherits(object, "derep")) {
1
} else if (inherits(object[[1]], "derep")) {
length(object)
} else if (is.character(object[1]) &&
length(object[1]) == 1 &&
file.exists(object[1])) {
length(object)
} else {
NA
}
})
if (!is.null(taxonomy_rank)) {
message("Compute the number of values in taxonomic rank")
track_nb_tax_value_per_obj <-
pbapply::pblapply(list_of_objects, function(object) {
message(paste("Start object of class:", class(object), sep = " "))
if (inherits(object, "phyloseq")) {
if (taxa_are_rows(object)) {
apply(object@tax_table[taxonomy_rank, ], 1, function(x) {
length(unique(stats::na.omit(x)))
})
} else {
apply(object@tax_table[, taxonomy_rank], 2, function(x) {
length(unique(stats::na.omit(x)))
})
}
} else {
rep(NA, length(taxonomy_rank))
}
})
names_taxonomic_rank <-
pbapply::pblapply(list_of_objects, function(object) {
message(paste("Start object of class:", class(object), sep = " "))
if (inherits(object, "phyloseq")) {
if (taxa_are_rows(object)) {
rownames(object@tax_table)[taxonomy_rank]
} else {
colnames(object@tax_table)[taxonomy_rank]
}
}
})
track <- plyr::rbind.fill.matrix(
matrix(ncol = length(list_of_objects), unlist(track_nb_seq_per_obj)),
matrix(
ncol = length(list_of_objects),
unlist(track_nb_cluster_per_obj)
),
matrix(ncol = length(list_of_objects), unlist(track_nb_sam_per_obj)),
matrix(
ncol = length(list_of_objects),
unlist(track_nb_tax_value_per_obj)
)
)
rownames(track) <- c(
"nb_sequences",
"nb_clusters",
"nb_samples",
names_taxonomic_rank[[1]]
)
} else {
track <- plyr::rbind.fill.matrix(
matrix(ncol = length(list_of_objects), unlist(track_nb_seq_per_obj)),
matrix(
ncol = length(list_of_objects),
unlist(track_nb_cluster_per_obj)
),
matrix(ncol = length(list_of_objects), unlist(track_nb_sam_per_obj))
)
rownames(track) <- c(
"nb_sequences",
"nb_clusters",
"nb_samples"
)
}
track <- as.data.frame(t(track))
if (!is.null(obj_names)) {
rownames(track) <- obj_names
} else {
rownames(track) <- names(list_of_objects)
}
return(track)
}
################################################################################
################################################################################
#' Track the number of reads (= sequences), samples and cluster (e.g. ASV)
#' for each sample
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Contrary to [track_wkflow()], only phyloseq object are possible.
#' More information are available in the manual of the function [track_wkflow()]
#'
#' @param list_pq_obj (required): a list of object passed on to [track_wkflow()]
#' Only phyloseq object will return value because information of sample is needed
#' @param ... Other args passed on to [track_wkflow()]
#'
#' @return A list of dataframe. cf [track_wkflow()] for more information
#'
#' @export
#' @author Adrien Taudière
#'
#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"
#' tree_A10_005 <- subset_samples(data_fungi, Tree_name == "A10-005")
#' if (requireNamespace("pbapply")) {
#' track_wkflow_samples(tree_A10_005)
#' }
track_wkflow_samples <- function(list_pq_obj, ...) {
if (!inherits(list_pq_obj, "list")) {
list_pq_obj <- list(list_pq_obj)
}
if (sum(!unlist(lapply(list_pq_obj, inherits, "phyloseq"))) != 0) {
stop("At least one object in your list_pq_obj is not a phyloseq obj.")
}
res <- list()
sam_names <- unique(unlist(lapply(list_pq_obj, sample_names)))
for (s in sam_names) {
list_pq_obj_samples <-
lapply(list_pq_obj, function(physeq) {
if (sum(sample_names(physeq) %in% s) == 1) {
select_one_sample(physeq, sam_name = s)
} else {
matrix(0, nrow = 0, ncol = 0)
}
})
res[[s]] <- track_wkflow(list_pq_obj_samples) # ,...)
}
return(res)
}
###########################################################################
################################################################################
#' Recluster sequences of an object of class `physeq`
#' or a list of DNA sequences
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' This function use the `merge_taxa_vec` function to merge taxa into clusters.
#'
#' @inheritParams clean_pq
#' @param dna_seq You may directly use a character vector of DNA sequences
#' in place of physeq args. When physeq is set, dna sequences take the value of
#' `physeq@refseq`
#' @param nproc (default: 1)
#' Set to number of cpus/processors to use for the clustering
#' @param method (default: clusterize)
#' Set the clustering method.
#' - `clusterize` use the [DECIPHER::Clusterize()] fonction,
#' - `vsearch` use the vsearch software (https://github.com/torognes/vsearch)
#' with arguments `--cluster_size` by default (see args `vsearch_cluster_method`)
#' and `-strand both` (see args `vsearch_args`)
#' - `swarm` use the swarm
#' @param vsearchpath (default: vsearch) path to vsearch
#' @param id (default: 0.97) level of identity to cluster
#' @param tax_adjust (Default 0) See the man page
#' of [merge_taxa_vec()] for more details.
#' To conserved the taxonomic rank of the most abundant ASV,
#' set tax_adjust to 0 (default). For the moment only tax_adjust = 0 is
#' robust
#' @param vsearch_cluster_method (default: "--cluster_size) See other possible
#' methods in the [vsearch manual](https://github.com/torognes/vsearch/) (e.g. `--cluster_size` or `--cluster_smallmem`)
#' - `--cluster_fast` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence length beforehand.
#' - `--cluster_size` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence abundance beforehand.
#' - `--cluster_smallmem` : Clusterize the fasta sequences in filename without automatically modifying their order beforehand. Sequence are expected to be sorted by decreasing sequence length, unless *--usersort* is used.
#' In that case you may set `vsearch_args` to vsearch_args = "--strand both --usersort"
#' @param vsearch_args (default : "--strand both") a one length character element defining other parameters to
#' passed on to vsearch.
#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
#' - temp.fasta (refseq in fasta or dna_seq sequences)
#' - cluster.fasta (centroid if method = "vsearch")
#' - temp.uc (clusters if method = "vsearch")
#' @param swarmpath (default: swarm) path to swarm
#' @param d (default: 1) maximum number of differences allowed between two
#' amplicons, meaning that two amplicons will be grouped if they have `d`
#' (or less) differences
#' @param swarm_args (default : "--fastidious") a one length character
#' element defining other parameters to passed on to swarm See other possible
#' methods in the [SWARM pdf manual](https://github.com/torognes/swarm/blob/master/man/swarm_manual.pdf)
#' @param method_clusterize (default "overlap") the method for the [DECIPHER::Clusterize()] method
#' @param ... Other arguments passed on to [DECIPHER::Clusterize()]
#' @details This function use the `merge_taxa_vec` function to
#' merge taxa into clusters. By default tax_adjust = 0. See the man page
#' of [merge_taxa_vec()].
#'
#' @return A new object of class `physeq` or a list of cluster if dna_seq
#' args was used.
#'
#' @examples
#' if (requireNamespace("DECIPHER")) {
#' asv2otu(data_fungi_mini)
#' }
#' \donttest{
#' if (requireNamespace("DECIPHER")) {
#' asv2otu(data_fungi_mini, method_clusterize = "longest")
#'
#' if (MiscMetabar::is_swarm_installed()) {
#' d_swarm <- asv2otu(data_fungi_mini, method = "swarm")
#' }
#' if (MiscMetabar::is_vsearch_installed()) {
#' d_vs <- asv2otu(data_fungi_mini, method = "vsearch")
#' }
#' }
#' }
#' @references
#' VSEARCH can be downloaded from
#' \url{https://github.com/torognes/vsearch}.
#' More information in the associated publication
#' \url{https://pubmed.ncbi.nlm.nih.gov/27781170}.
#' @seealso [vsearch_clustering()] and [swarm_clustering()]
#' @export
#' @author Adrien Taudière
asv2otu <- function(physeq = NULL,
dna_seq = NULL,
nproc = 1,
method = "clusterize",
id = 0.97,
vsearchpath = "vsearch",
tax_adjust = 0,
vsearch_cluster_method = "--cluster_size",
vsearch_args = "--strand both",
keep_temporary_files = FALSE,
swarmpath = "swarm",
d = 1,
swarm_args = "--fastidious",
method_clusterize = "overlap",
...) {
if (inherits(physeq, "phyloseq")) {
verify_pq(physeq)
if (is.null(physeq@refseq)) {
stop("The phyloseq object do not contain a @refseq slot")
}
dna <- Biostrings::DNAStringSet(physeq@refseq)
if (!is.null(dna_seq)) {
stop("You must use either physeq or dna_seq args but not both")
}
} else if (inherits(dna_seq, "character")) {
dna <- Biostrings::DNAStringSet(dna_seq)
} else {
stop(
"You must set the args physeq (object of class phyloseq) or
dna_seq (character vector)."
)
}
if (method == "clusterize") {
## Find clusters of ASVs to form the new OTUs
clusters <- DECIPHER::Clusterize(dna,
cutoff = 1 - id,
# e.g. `cutoff = 0.03` for a 97% OTU
processors = nproc,
method = method_clusterize,
...
)
if (inherits(physeq, "phyloseq")) {
new_obj <-
merge_taxa_vec(physeq,
clusters$cluster,
tax_adjust = tax_adjust
)
} else if (inherits(dna_seq, "character")) {
new_obj <- clusters
} else {
stop(
"You must set the args physeq (object of class phyloseq) or
dna_seq (character vector)."
)
}
} else if (method == "vsearch") {
new_obj <- vsearch_clustering(
physeq = physeq,
dna_seq = dna_seq,
nproc = nproc,
id = id,
vsearchpath = vsearchpath,
tax_adjust = tax_adjust,
vsearch_cluster_method = vsearch_cluster_method,
vsearch_args = vsearch_args,
keep_temporary_files = keep_temporary_files
)
} else if (method == "swarm") {
new_obj <- swarm_clustering(
physeq = physeq,
dna_seq = dna_seq,
d = d,
swarmpath = swarmpath,
vsearch_path = vsearchpath,
nproc = nproc,
swarm_args = swarm_args,
tax_adjust = tax_adjust,
keep_temporary_files = keep_temporary_files
)
} else {
stop("Method allows 2 values only : `clusterize`, `vsearch` or `swarm`")
}
return(new_obj)
}
################################################################################
################################################################################
#' Save phyloseq object in the form of multiple csv tables.
#'
#' @description
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' This is the reverse function of [read_pq()].
#' @inheritParams clean_pq
#' @param path a path to the folder to save the phyloseq object
#' @param rdata (logical) does the phyloseq object is also saved in Rdata format?
#' @param one_file (logical) if TRUE, combine all data in one file only
#' @param write_sam_data (logical) does the samples data are add to
#' the file. Only used if `one_file` is TRUE.
#' Note that these option result in a lot of NA values.
#' @param sam_data_first (logical) if TRUE, put the sample data at the top of the table
#' Only used if `one_file` and write_sam_data are both TRUE.
#' @param clean_pq (logical)
#' If set to TRUE, empty samples are discarded after subsetting ASV
#' @param reorder_asv (logical) if TRUE the otu_table is ordered by the number of
#' sequences of ASV (descending order). Default to TRUE. Only possible if clean_pq
#' is set to TRUE.
#' @param rename_asv reorder_asv (logical) if TRUE, ASV are renamed by their position
#' in the OTU_table (asv_1, asv_2, ...). Default to FALSE. Only possible if clean_pq
#' is set to TRUE.
#' @param quote a logical value (default FALSE) or a numeric vector.
#' If TRUE, any character or factor columns will be surrounded by
#' double quotes. If a numeric vector, its elements are taken
#' as the indices of columns to quote. In both cases, row and
#' column names are quoted if they are written. If FALSE nothing is quoted.
#' @param sep_csv (default tabulation) separator for column
#' @param ... Other arguments passed on to [utils::write.table()] function.
#' @return Build a folder (path) containing one to four csv tables
#' (refseq.csv, otu_table.csv, tax_table.csv, sam_data.csv)
#' and if present a phy_tree in Newick format
#' @export
#' @author Adrien Taudière
#' @examples
#' write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"))
#' write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"), one_file = TRUE)
#' unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)
#' @seealso [MiscMetabar::save_pq()]
write_pq <- function(physeq,
path = NULL,
rdata = FALSE,
one_file = FALSE,
write_sam_data = TRUE,
sam_data_first = FALSE,
clean_pq = TRUE,
reorder_asv = FALSE,
rename_asv = FALSE,
remove_empty_samples = TRUE,
remove_empty_taxa = TRUE,
clean_samples_names = TRUE,
silent = FALSE,
verbose = FALSE,
quote = FALSE,
sep_csv = "\t",
...) {
verify_pq(physeq)
physeq <- clean_pq(
physeq,
reorder_asv = reorder_asv,
rename_asv = rename_asv,
remove_empty_samples = remove_empty_samples,
remove_empty_taxa = remove_empty_taxa,
clean_samples_names = clean_samples_names,
silent = silent,
verbose = verbose
)
if (!dir.exists(path)) {
dir.create(file.path(path), recursive = TRUE)
}
if (one_file) {
if (!is.null(physeq@refseq) &&
!is.null(physeq@otu_table) && !is.null(physeq@tax_table)) {
if (!taxa_are_rows(physeq)) {
otu_table(physeq) <-
otu_table(
t(as.matrix(unclass(
physeq@otu_table
))),
taxa_are_rows = TRUE
)
}
df_physeq_interm <- cbind(
physeq@otu_table,
physeq@tax_table,
as.vector(physeq@refseq)
)
colnames(df_physeq_interm) <-
c(
sample_names(physeq),
colnames(physeq@tax_table),
"Reference Sequences"
)
df_physeq_interm <- as.data.frame(df_physeq_interm)
if (write_sam_data) {
sam_data <- data.frame(t(data.frame(unclass(
physeq@sam_data
))))
colnames(sam_data) <- sample_names(physeq)
if (sam_data_first) {
df_physeq <- dplyr::full_join(sam_data, df_physeq_interm)
rownames(df_physeq) <-
c(rownames(sam_data), rownames(df_physeq_interm))
} else {
df_physeq <- dplyr::full_join(df_physeq_interm, sam_data)
rownames(df_physeq) <-
c(rownames(df_physeq_interm), rownames(sam_data))
}
} else {
df_physeq <- df_physeq_interm
}
utils::write.table(
df_physeq,
paste0(path, "/ASV_table_allInOne.csv"),
quote = quote,
sep = sep_csv,
...
)
} else if (!is.null(physeq@otu_table) &&
!is.null(physeq@tax_table)) {
if (!taxa_are_rows(physeq)) {
otu_table(physeq) <-
otu_table(
t(as.matrix(unclass(
physeq@otu_table
))),
taxa_are_rows = TRUE
)
}
df_physeq_interm <- cbind(
physeq@otu_table,
physeq@tax_table,
)
colnames(df_physeq_interm) <-
c(
sample_names(physeq),
colnames(physeq@tax_table),
"Reference Sequences"
)
df_physeq_interm <- as.data.frame(df_physeq_interm)
if (write_sam_data) {
sam_data <- data.frame(t(data.frame(unclass(
physeq@sam_data
))))
colnames(sam_data) <- sample_names(physeq)
if (sam_data_first) {
df_physeq <- dplyr::full_join(sam_data, df_physeq_interm)
rownames(df_physeq) <-
c(rownames(sam_data), rownames(df_physeq_interm))
} else {
df_physeq <- dplyr::full_join(df_physeq_interm, sam_data)
rownames(df_physeq) <-
c(rownames(df_physeq_interm), rownames(sam_data))
}
}
utils::write.table(
df_physeq,
paste0(path, "/ASV_table_allInOne.csv"),
quote = quote,
sep = sep_csv,
...
)
}
} else {
if (!is.null(physeq@otu_table)) {
utils::write.table(
physeq@otu_table,
paste0(path, "/otu_table.csv"),
quote = quote,
sep = sep_csv,
...
)
}
if (!is.null(physeq@refseq)) {
utils::write.table(
physeq@refseq,
paste0(path, "/refseq.csv"),
quote = quote,
sep = sep_csv,
...
)
}
if (!is.null(physeq@tax_table)) {
utils::write.table(
physeq@tax_table,
paste0(path, "/tax_table.csv"),
quote = quote,
sep = sep_csv,
col.names = NA,
...
)
}
if (!is.null(physeq@sam_data)) {
utils::write.table(
as.matrix(physeq@sam_data),
paste0(path, "/sam_data.csv"),
quote = quote,
sep = sep_csv,
col.names = NA,
...
)
}
}
if (!is.null(physeq@phy_tree)) {
ape::write.tree(physeq@phy_tree, paste(path, "/phy_tree.txt", sep = ""))
}
if (rdata) {
save(physeq, file = paste(path, "/physeq.RData", sep = ""))
}
}
################################################################################
################################################################################
#' A wrapper of write_pq to save in all three possible formats
#'
#' @details
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' Write :
#' - 4 separate tables
#' - 1 table version
#' - 1 RData file
#'
#' @inheritParams clean_pq
#' @param path a path to the folder to save the phyloseq object
#' @param ... Other arguments passed on to [write_pq()] or [utils::write.table()] function.
#' @return Build a folder (in path) with four csv tables (`refseq.csv`, `otu_table.csv`, `tax_table.csv`, `sam_data.csv`) + one
#' table with all tables together + a rdata file (`physeq.RData`) that can be loaded using
#' [base::load()] function + if present a phylogenetic tree in Newick format (`phy_tree.txt`)
#' @export
#' @author Adrien Taudière
#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"
#' save_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"))
#' unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)
#' @seealso [MiscMetabar::write_pq()]
save_pq <- function(physeq, path = NULL, ...) {
write_pq(physeq,
path = path,
rdata = TRUE,
one_file = TRUE,
...
)
write_pq(physeq,
path = path,
rdata = FALSE,
one_file = FALSE,
...
)
}
################################################################################
#' Read phyloseq object from multiple csv tables and a phylogenetic tree
#' in Newick format.
#'
#' @description
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' This is the reverse function of [write_pq()].
#'
#' @param path (required) a path to the folder to read the phyloseq object
#' @param taxa_are_rows (default to FALSE) see ?phyloseq for details
#' @param sam_names The name of the variable (column) in sam_data.csv to rename
#' samples. Note that if you use [write_phyloseq()] function to save your
#' physeq object, you may use sam_names = "X" to rename the samples names
#' as before.
#' @param sep_csv (default tabulation) separator for column
#' @param ... Other arguments passed on to [utils::write.table()] function.
#' @return One to four csv tables (refseq.csv, otu_table.csv, tax_table.csv, sam_data.csv)
#' and if present a phy_tree in Newick format. At least the otu_table.csv need to be present.
#' @export
#'
#' @examples
#' write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"))
#' read_pq(path = paste0(tempdir(), "/phyloseq"))
#' unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)
read_pq <- function(path = NULL,
taxa_are_rows = FALSE,
sam_names = NULL,
sep_csv = "\t",
...) {
if (file.exists(paste0(path, "/otu_table.csv"))) {
if (taxa_are_rows) {
otu_table_csv <-
as.matrix(utils::read.table(paste0(path, "/otu_table.csv"), sep = sep_csv))
samp_names <- colnames(otu_table_csv)
otu_table_csv <- apply(otu_table_csv, 2, as.numeric)
table_otu <- otu_table(otu_table_csv, taxa_are_rows = TRUE)
sample_names(table_otu) <- samp_names
physeq <- phyloseq(table_otu)
} else {
otu_table_csv <-
as.matrix(utils::read.table(paste0(path, "/otu_table.csv"), sep = sep_csv))
samp_names <- rownames(otu_table_csv)
otu_table_csv <- apply(otu_table_csv, 2, as.numeric)
rownames(otu_table_csv) <- samp_names
physeq <-
phyloseq(otu_table(otu_table_csv, taxa_are_rows = FALSE))
}
}
if (file.exists(paste0(path, "/refseq.csv"))) {
dna <-
Biostrings::DNAStringSet(utils::read.table(
paste0(path, "/refseq.csv"),
sep = sep_csv,
row.names = NULL
)[, 2])
names(dna) <-
utils::read.table(paste0(path, "/refseq.csv"),
sep = sep_csv,
row.names = NULL
)[, 1]
physeq <- phyloseq::merge_phyloseq(physeq, refseq(dna))
}
if (file.exists(paste0(path, "/tax_table.csv"))) {
tax_table_csv <-
utils::read.table(paste0(path, "/tax_table.csv"), sep = sep_csv)
rownames(tax_table_csv) <- tax_table_csv[, 1]
tax_table_csv <- as.matrix(tax_table_csv[, -1])
physeq <-
phyloseq::merge_phyloseq(physeq, tax_table(tax_table_csv))
}
if (file.exists(paste0(path, "/sam_data.csv"))) {
sam_data_csv <-
utils::read.table(paste0(path, "/sam_data.csv"), sep = sep_csv)
rownames(sam_data_csv) <- sam_data_csv[, 1]
physeq <-
phyloseq::merge_phyloseq(physeq, sample_data(sam_data_csv))
}
if (!is.null(physeq@phy_tree)) {
tree <- ape::read.tree(paste0(path, "/phy_tree.txt"))
physeq <- phyloseq::merge_phyloseq(physeq, phy_tree(tree))
}
if (!is.null(sam_names)) {
sample_names(physeq) <- unclass(physeq@sam_data[, sam_names])[[1]]
}
return(physeq)
}
################################################################################
################################################################################
#' Lulu reclustering of class `physeq`
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' See https://www.nature.com/articles/s41467-017-01312-x for more information
#' on the method.
#'
#' @inheritParams clean_pq
#' @param nproc (default 1)
#' Set to number of cpus/processors to use for the clustering
#' @param id (default: 0.84) id for --usearch_global.
#' @param vsearchpath (default: vsearch) path to vsearch.
#' @param verbose (logical) if true, print some additional messages.
#' @param clean_pq (logical) if true, empty samples and empty ASV are discarded
#' before clustering.
#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
#' @param ... Others args for function [lulu()]
#' @return a list of for object
#' - "new_physeq": The new phyloseq object (class physeq)
#' - "discrepancy_vector": A vector of discrepancy showing for each taxonomic
#' level the proportion of identic value before and after lulu reclustering.
#' A value of 0.6 stands for 60% of ASV before re-clustering have
#' identical value after re-clustering. In other word, 40% of ASV are assigned
#' to a different taxonomic
#' value. NA value are not counted as discrepancy.
#' - "res_lulu": A list of the result from the lulu function
#' - "merged_ASV": the data.frame used to merged ASV
#'
#' @export
#' @examplesIf MiscMetabar::is_vsearch_installed()
#' \donttest{
#' lulu_pq(data_fungi_sp_known)
#' }
#' @author Tobias Guldberg Frøslev \email{tobiasgf@snm.ku.dk}
#' & Adrien Taudière \email{adrien.taudiere@@zaclys.net}
#' @details
#' The version of LULU is a fork of Adrien Taudière (\url{https://github.com/adrientaudiere/lulu})
#' from \url{https://github.com/tobiasgf/lulu}
#' @references
#' - LULU : \url{https://github.com/adrientaudiere/lulu}
#' forked from \url{https://github.com/tobiasgf/lulu}.
#' - VSEARCH can be downloaded from
#' \url{https://github.com/torognes/vsearch}.
lulu_pq <- function(physeq,
nproc = 1,
id = 0.84,
vsearchpath = "vsearch",
verbose = FALSE,
clean_pq = FALSE,
keep_temporary_files = FALSE,
...) {
verify_pq(physeq)
if (is.null(physeq@refseq)) {
stop("The phyloseq object do not contain a @refseq slot")
}
if (clean_pq) {
physeq <- clean_pq(physeq)
}
message("Start Vsearch usearch_global")
dna <- Biostrings::DNAStringSet(physeq@refseq)
Biostrings::writeXStringSet(dna, "temp.fasta")
system2(
vsearchpath,
paste(
" --usearch_global temp.fasta --db temp.fasta --self --iddef 1",
" -userfields query+target+id --maxaccepts 0 --query_cov .9 --maxhits 10",
" -id ",
id,
" --userout match_list.txt",
sep = ""
),
stdout = TRUE,
stderr = TRUE
)
match_list <- utils::read.csv(file = "match_list.txt", sep = "\t")
message("Lulu algorithm")
res_lulu <-
lulu(data.frame(t(physeq@otu_table), ...), match_list)
if (!keep_temporary_files) {
if (file.exists("temp.fasta")) {
unlink("temp.fasta")
}
if (file.exists("cluster.fasta")) {
unlink("cluster.fasta")
}
if (file.exists("temp.uc")) {
unlink("temp.uc")
}
if (file.exists("match_list.txt")) {
unlink("match_list.txt")
}
}
merged <- res_lulu$otu_map[res_lulu$otu_map$curated == "merged", ]
merged <- merged[rownames(merged) != merged$parent_id, ]
test_vector <- vector(mode = "logical")
for (tax_rank in colnames(physeq@tax_table)) {
test <-
physeq@tax_table[rownames(merged), tax_rank] == physeq@tax_table[merged$parent_id, tax_rank]
test_vector <-
c(
test_vector,
sum(test, na.rm = TRUE) / length(stats::na.exclude(test))
)
}
names(test_vector) <- colnames(physeq@tax_table)
new_physeq <-
prune_taxa(
taxa_names(physeq) %in% rownames(res_lulu$curated_table),
physeq
)
new_physeq@otu_table <-
otu_table(t(res_lulu$curated_table), taxa_are_rows = FALSE)
sample_names(new_physeq) <- sample_names(physeq)
if (verbose) {
message(paste(
"The number of taxa decrease from ",
ntaxa(physeq),
" to ",
ntaxa(new_physeq),
".",
sep = ""
))
message(
"See the discrepancy_vector to verify the degree of discrepancy in taxonomy due to lulu re-clustering."
)
}
return(
list(
"new_physeq" = new_physeq,
"discrepancy_vector" = test_vector,
"res_lulu" = res_lulu,
"merged_ASV" = merged
)
)
}
################################################################################
################################################################################
#' MUMU reclustering of class `physeq`
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' See https://www.nature.com/articles/s41467-017-01312-x for more information
#' on the original method LULU. This is a wrapper of
#' [mumu](https://github.com/frederic-mahe/mumu) a C++ re-implementation
#' of LULU by Frédéric Mahé
#'
#' @inheritParams clean_pq
#' @param nproc (default 1)
#' Set to number of cpus/processors to use for the clustering
#' @param id (default: 0.84) id for --usearch_global.
#' @param vsearchpath (default: vsearch) path to vsearch.
#' @param mumupath path to mumu. See [mumu](https://github.com/frederic-mahe/mumu)
#' for installation instruction
#' @param verbose (logical) if true, print some additional messages.
#' @param clean_pq (logical) if true, empty samples and empty ASV are discarded
#' before clustering.
#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
#' @return a list of for object
#' - "new_physeq": The new phyloseq object (class physeq)
#' - "mumu_results": The log file of the mumu software. Run `man mumu` into
#' bash to obtain details about columns' signification.
#'
#' @export
#' @examplesIf MiscMetabar::is_mumu_installed()
#' \dontrun{
#' mumu_pq(data_fungi_sp_known)
#' }
#' @author Frédéric Mahé
#' & Adrien Taudière \email{adrien.taudiere@@zaclys.net}
#' @references
#' - MUMU: \url{https://github.com/frederic-mahe/mumu}
#' - VSEARCH can be downloaded from
#' \url{https://github.com/torognes/vsearch}.
#' @details
#' This function is mainly a wrapper of the work of others.
#' Please cite [mumu](https://github.com/frederic-mahe/mumu/blob/main/CITATION.cff) and
#' [lulu](https://www.nature.com/articles/s41467-017-01312-x) if you use this function
#' for your work.
#'
mumu_pq <- function(physeq,
nproc = 1,
id = 0.84,
vsearchpath = "vsearch",
mumupath = "mumu",
verbose = FALSE,
clean_pq = TRUE,
keep_temporary_files = FALSE) {
verify_pq(physeq)
if (is.null(physeq@refseq)) {
stop("The phyloseq object do not contain a @refseq slot")
}
if (clean_pq) {
physeq <- clean_pq(physeq)
}
message("Start Vsearch usearch_global")
dna <- Biostrings::DNAStringSet(physeq@refseq)
Biostrings::writeXStringSet(dna, "temp.fasta")
system2(
vsearchpath,
paste(
" --usearch_global temp.fasta --db temp.fasta --self --iddef 1",
" -userfields query+target+id --maxaccepts 0 --query_cov 0.9 --maxhits 10",
" -id ",
id,
" --userout match_list.txt"
),
stdout = TRUE,
stderr = TRUE
)
otu_tab <-
data.frame(unclass(taxa_as_rows(physeq)@otu_table))
otu_tab <- cbind("ASV" = rownames(otu_tab), otu_tab)
write.table(
otu_tab,
"otu_table.csv",
sep = "\t",
row.names = FALSE,
quote = FALSE
)
message("Mumu algorithm")
system2(
mumupath,
paste(
"--otu_table otu_table.csv",
"--match_list match_list.txt",
"--log log.txt",
"--new_otu_table new_OTU.tablemumu"
)
)
res_mumu <- read.delim("new_OTU.tablemumu")
new_otu_tab <- otu_table(res_mumu[, -1], taxa_are_rows = TRUE)
taxa_names(new_otu_tab) <- res_mumu[, 1]
new_physeq <-
prune_taxa(taxa_names(physeq) %in% taxa_names(new_otu_tab), physeq)
new_physeq@otu_table <-
otu_table(t(new_otu_tab), taxa_are_rows = FALSE)
if (nsamples(new_physeq) != nsamples(physeq)) {
stop(
"There is a different number of samples before and after mumu algorithm.
This may be due to empty samples. You may try to rerun mumu_pq()
using clean_pq = TRUE."
)
}
sample_names(new_physeq) <- sample_names(physeq)
if (verbose) {
message(paste(
"The number of taxa decrease from ",
ntaxa(physeq),
" to ",
ntaxa(new_physeq),
".",
sep = ""
))
message(
"See the log slot to verify the degree of discrepancy in taxonomy due to mumu re-clustering."
)
}
result_mumu <- read.delim("log.txt")
colnames(result_mumu) <-
c(
"Query_ASV",
"Potential parent",
"Similarity_percent",
"Ab_query",
"Ab_parent",
"Overlap_ab_query",
"Overlap_ab_parent",
"Incidence_query",
"Incidence_parent",
"Smallest_ab_ratio",
"Sum_ab_ratio",
"Average_ratio",
"Average_non_null_ratio",
"Relative_cooccurence_value",
"Status"
)
if (!keep_temporary_files) {
if (file.exists("temp.fasta")) {
unlink("temp.fasta")
}
if (file.exists("cluster.fasta")) {
unlink("cluster.fasta")
}
if (file.exists("temp.uc")) {
unlink("temp.uc")
}
if (file.exists("log.txt")) {
unlink("temp.uc")
}
if (file.exists("match_list.txt")) {
unlink("match_list.txt")
}
if (file.exists("otu_table.csv")) {
unlink("otu_table.csv")
}
if (file.exists("new_OTU.tablemumu")) {
unlink("new_OTU.tablemumu")
}
}
return(list(
"new_physeq" = new_physeq,
"mumu_results" = result_mumu
))
}
################################################################################
################################################################################
#' Verify the validity of a phyloseq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' Mostly for internal use in MiscMetabar functions.
#'
#' @inheritParams clean_pq
#' @param verbose (logical, default FALSE) If TRUE, prompt some warnings.
#' @param min_nb_seq_sample (numeric) Only used if verbose = TRUE.
#' Minimum number of sequences per samples to not show warning.
#' @param min_nb_seq_taxa (numeric) Only used if verbose = TRUE.
#' Minimum number of sequences per taxa to not show warning.
#' @return Nothing if the phyloseq object is valid. An error in the other case.
#' Warnings if verbose = TRUE
#' @export
#'
verify_pq <- function(
physeq,
verbose = FALSE,
min_nb_seq_sample = 500,
min_nb_seq_taxa = 1) {
if (!methods::validObject(physeq) ||
!inherits(physeq, "phyloseq")) {
stop("The physeq argument is not a valid phyloseq object.")
}
if (verbose) {
if (min(sample_sums(physeq)) < min_nb_seq_sample) {
warning(paste0(
"At least one of your sample contains less than ",
min_nb_seq_sample,
" sequences."
))
}
if (min(sample_sums(physeq)) < min_nb_seq_sample) {
warning(paste0(
"At least one of your taxa is represent by less than ",
min_nb_seq_taxa,
" sequences."
))
}
if (sum(is.na(physeq@sam_data)) > 0) {
warning("At least one of your samples metadata columns contains NA.")
}
if (sum(grepl("^[0-9]", sample_names(physeq)) > 0) && !silent) {
message(
"At least one sample name start with a number.
It may introduce bug in some function such
as psmelt. You may replace sample_names using
for example :
sample_names(physeq) <- paste('samp', sample_names(physeq))"
)
}
}
}
################################################################################
################################################################################
#' Subset samples using a conditional boolean vector.
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' The main objective of this function is to complete the
#' [phyloseq::subset_samples()] function by propose a more easy
#' (but more prone to error) way of subset_samples.
#' It replace the subsetting expression which used the name of the variable
#' in the sam_data by a boolean vector.
#'
#' Warnings: you must verify the result of this function as the
#' boolean condition must match the order of samples in the `sam_data`
#' slot.
#'
#' This function is robust when you use the sam_data slot of the phyloseq object
#' used in physeq (see examples)
#'
#' @inheritParams clean_pq
#' @param condition A boolean vector to subset samples. Length must fit
#' the number of samples
#'
#' @examples
#'
#' cond_samp <- grepl("A1", data_fungi@sam_data[["Sample_names"]])
#' subset_samples_pq(data_fungi, cond_samp)
#'
#' subset_samples_pq(data_fungi, data_fungi@sam_data[["Height"]] == "Low")
#'
#' @return a new phyloseq object
#' @export
#'
subset_samples_pq <- function(physeq, condition) {
if (length(condition) != nsamples(physeq)) {
stop("Length of condition is different from the number of samples.")
}
if (is.null(physeq@sam_data)) {
message("Nothing subset. No sample_data in physeq.\n")
return(physeq)
} else {
old_DF <- as(sample_data(physeq), "data.frame")
new_DF <- old_DF[condition, ]
if (inherits(physeq, "sample_data")) {
return(sample_data(new_DF))
} else {
sample_data(physeq) <- sample_data(new_DF)
return(physeq)
}
}
}
################################################################################
################################################################################
#' Subset taxa using a conditional named boolean vector.
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' The main objective of this function is to complete the
#' [phyloseq::subset_taxa()] function by propose a more easy way of
#' subset_taxa using a named boolean vector. Names must match taxa_names.
#'
#' @inheritParams clean_pq
#' @param condition A named boolean vector to subset taxa. Length must fit
#' the number of taxa and names must match taxa_names. Can also be a
#' condition using a column of the tax_table slot (see examples). If
#' the order of condition is the same as taxa_names(physeq),
#' you can use the parameter `taxa_names_from_physeq = TRUE`.
#' @param clean_pq (logical)
#' If set to TRUE, empty samples are discarded after subsetting ASV
#' @param verbose (logical) Informations are printed
#' @param taxa_names_from_physeq (logical) If set to TRUE, rename the
#' condition vector using taxa_names(physeq). Carefully check the result
#' of this function if you use this parameter. No effect if the condition
#' is of class `tax_table`.
#' @examples
#'
#' subset_taxa_pq(data_fungi, data_fungi@tax_table[, "Phylum"] == "Ascomycota")
#'
#' cond_taxa <- grepl("Endophyte", data_fungi@tax_table[, "Guild"])
#' names(cond_taxa) <- taxa_names(data_fungi)
#' subset_taxa_pq(data_fungi, cond_taxa)
#'
#' subset_taxa_pq(data_fungi, grepl("mycor", data_fungi@tax_table[, "Guild"]),
#' taxa_names_from_physeq = TRUE
#' )
#'
#' @return a new phyloseq object
#' @export
#'
subset_taxa_pq <- function(physeq,
condition,
verbose = TRUE,
clean_pq = TRUE,
taxa_names_from_physeq = FALSE) {
if (inherits(condition, "taxonomyTable")) {
condition_temp <- as.vector(condition)
names(condition_temp) <- rownames(condition)
condition <- condition_temp
} else {
if (taxa_names_from_physeq) {
names(condition) <- taxa_names(physeq)
}
}
if (!sum(names(condition) %in% taxa_names(physeq)) == length(condition)) {
stop(paste(
"Some names in condition do not fit taxa_names of physeq : ",
paste(names(condition)[!names(condition) %in% taxa_names(physeq)],
collapse = "/"
)
))
}
new_physeq <- physeq
if (!taxa_are_rows(new_physeq)) {
new_physeq@otu_table <-
otu_table(t(new_physeq@otu_table), taxa_are_rows = TRUE)
taxa_are_rows(new_physeq) <- TRUE
}
cond <- condition[match(taxa_names(new_physeq), names(condition))]
cond[is.na(cond)] <- FALSE
old_MA <-
as(otu_table(new_physeq, taxa_are_rows = TRUE), "matrix")
new_MA <- old_MA[cond, ]
if (!is.matrix(new_MA)) {
new_MA <- as.matrix(new_MA)
new_otu_table <- otu_table(new_MA, taxa_are_rows = TRUE)
sample_names(new_otu_table) <- sample_names(new_physeq)
} else {
new_otu_table <- otu_table(new_MA, taxa_are_rows = TRUE)
}
otu_table(new_physeq) <- new_otu_table
if (clean_pq) {
new_physeq <- clean_pq(new_physeq, verbose = TRUE)
}
if (verbose) {
message(paste("Number of non-matching ASV", sum(is.na(
match(taxa_names(physeq), names(condition))
))))
message(paste("Number of matching ASV", sum(!is.na(
match(taxa_names(physeq), names(condition))
))))
message(paste(
"Number of filtered-out ASV",
ntaxa(physeq) - ntaxa(new_physeq)
))
message(paste("Number of kept ASV", ntaxa(new_physeq)))
message(paste("Number of kept samples", nsamples(new_physeq)))
}
return(new_physeq)
}
################################################################################
################################################################################
#' Select one sample from a physeq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Mostly for internal used, for example in function [track_wkflow_samples()].
#'
#' @inheritParams clean_pq
#' @param sam_name (required) The sample name to select
#' @param silent (logical) If true, no message are printing.
#' @return A new \code{\link{phyloseq-class}} object with one sample
#'
#' @export
#'
#' @author Adrien Taudière
#'
#' @examples
#'
#' A8_005 <- select_one_sample(data_fungi, "A8-005_S4_MERGED.fastq.gz")
#' A8_005
select_one_sample <- function(physeq, sam_name, silent = FALSE) {
if (sum(sample_names(physeq) %in% sam_name) == 0) {
stop(
paste0(
"The sample ",
sam_name,
" is not present in the names of samples of your phyloseq physeq object.
You may use the sample_names() function."
)
)
}
cl_sam <-
clean_pq(subset_samples_pq(physeq, sample_names(physeq) == sam_name),
silent = TRUE
)
if (!silent) {
message(
paste0(
"You select 1 of ",
nsamples(physeq),
" samples and conserved ",
ntaxa(cl_sam),
" out of ",
ntaxa(physeq),
" taxa represented by ",
sum(cl_sam@otu_table),
" sequences (out of ",
sum(physeq@otu_table),
" sequences [",
perc(sum(cl_sam@otu_table), sum(physeq@otu_table)),
"%])"
)
)
}
return(cl_sam)
}
################################################################################
################################################################################
#' Add new taxonomic rank to a phyloseq object.
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' One of main use of this function is to add taxonomic assignment from
#' a new database.
#'
#' @inheritParams clean_pq
#' @param ref_fasta (required) A link to a database.
#' Pass on to `dada2::assignTaxonomy`.
#' @param suffix (character) The suffix to name the new columns.
#' If set to NULL (the default), the basename of the file reFasta
#' is used.
#' @param ... Other arguments pass on to `dada2::assignTaxonomy`.
#' @return A new \code{\link{phyloseq-class}} object with a larger slot tax_table"
#'
#' @export
#'
#' @author Adrien Taudière
#'
add_new_taxonomy_pq <- function(physeq, ref_fasta, suffix = NULL, ...) {
if (is.null(suffix)) {
suffix <- basename(ref_fasta)
}
tax_tab <-
dada2::assignTaxonomy(physeq@refseq, refFasta = ref_fasta, ...)
colnames(tax_tab) <-
make.unique(paste0(colnames(tax_tab), "_", suffix))
new_tax_tab <- tax_table(cbind(physeq@tax_table, tax_tab))
new_physeq <- physeq
tax_table(new_physeq) <- new_tax_tab
return(new_physeq)
}
################################################################################
################################################################################
#' Summarize information from sample data in a table
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' A wrapper for the [gtsummary::tbl_summary()] function in the case of `physeq`
#' object.
#'
#' @inheritParams clean_pq
#' @param remove_col_unique_value (logical, default TRUE) Do we remove
#' informative columns (categorical column with one value per samples),
#' e.g. samples names ?
#' @param ... Other arguments pass on to [gtsummary::tbl_summary()].
#' @return A new \code{\link{phyloseq-class}} object with a larger slot tax_table
#'
#' @export
#' @author Adrien Taudière
#' @examples
#' if (requireNamespace("gtsummary")) {
#' tbl_sum_samdata(data_fungi) %>%
#' gtsummary::as_kable()
#'
#' summary_samdata <- tbl_sum_samdata(data_fungi,
#' include = c("Time", "Height"),
#' type = list(Time ~ "continuous2", Height ~ "categorical"),
#' statistic = list(Time ~ c("{median} ({p25}, {p75})", "{min}, {max}"))
#' )
#' }
#' \donttest{
#' data(enterotype)
#' if (requireNamespace("gtsummary")) {
#' summary_samdata <- tbl_sum_samdata(enterotype)
#' summary_samdata <- tbl_sum_samdata(enterotype, include = !contains("SampleId"))
#' }
#' }
#' @details
#' This function is mainly a wrapper of the work of others.
#' Please make a reference to `gtsummary::tbl_summary()` if you
#' use this function.
tbl_sum_samdata <- function(physeq, remove_col_unique_value = TRUE, ...) {
tbl <- tibble(data.frame(physeq@sam_data))
if (remove_col_unique_value) {
tbl <- tbl[, !apply(tbl, 2, function(x) {
length(unique(x)) == nrow(tbl) && is.character(x)
})]
}
tbl_sum <- tbl %>% gtsummary::tbl_summary(...)
return(tbl_sum)
}
################################################################################
#' Add information about Guild for FUNGI the FUNGuild databse
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Please cite Nguyen et al. 2016 (\doi{doi:10.1016/j.funeco.2015.06.006})
#'
#' @inheritParams clean_pq
#' @param taxLevels Name of the 7 columns in tax_table required by funguild
#'
#' @return A new object of class `physeq` with Guild information added to
#' `tax_table` slot
#' @export
#' @author Adrien Taudière
#' @examples
#' \donttest{
#' if (requireNamespace("httr")) {
#' d_fung_mini <- add_funguild_info(data_fungi_mini,
#' taxLevels = c(
#' "Domain",
#' "Phylum",
#' "Class",
#' "Order",
#' "Family",
#' "Genus",
#' "Species"
#' )
#' )
#' sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE)
#' }
#' }
#' @details
#' This function is mainly a wrapper of the work of others.
#' Please make a reference to `FUNGuildR` package and the associate
#' [publication](https://www.sciencedirect.com/science/article/abs/pii/S1754504815000847) if you
#' use this function.
#' @seealso [plot_guild_pq()]
add_funguild_info <- function(physeq,
taxLevels = c(
"Kingdom",
"Phylum",
"Class",
"Order",
"Family",
"Genus",
"Species"
)) {
tax_tab <- physeq@tax_table
FUNGuild_assign <-
funguild_assign(data.frame(
"Taxonomy" =
apply(tax_tab[, taxLevels], 1,
paste,
collapse = ";"
)
))
tax_tab <-
as.matrix(cbind(
tax_tab,
FUNGuild_assign
))
physeq@tax_table <- tax_table(tax_tab)
return(physeq)
}
################################################################################
#' Plot information about Guild from tax_table slot previously
#' created with [add_funguild_info()]
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Graphical function.
#'
#' @inheritParams clean_pq
#' @param levels_order (Default NULL) A character vector to
#' reorder the levels of guild. See examples.
#' @param clean_pq (logical, default TRUE): Does the phyloseq
#' object is cleaned using the [clean_pq()] function?
#' @param ... Other params for be passed on to
#' [clean_pq()] function
#' @return A ggplot2 object
#'
#' @export
#' @author Adrien Taudière
#' @examples
#' \donttest{
#' if (requireNamespace("httr")) {
#' d_fung_mini <- add_funguild_info(data_fungi_mini,
#' taxLevels = c(
#' "Domain",
#' "Phylum",
#' "Class",
#' "Order",
#' "Family",
#' "Genus",
#' "Species"
#' )
#' )
#' sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE)
#'
#' p <- plot_guild_pq(d_fung_mini)
#' if (requireNamespace("patchwork")) {
#' (plot_guild_pq(subset_samples(d_fung_mini, Height == "Low"),
#' levels_order = p$data$Guild[order(p$data$nb_seq)]
#' ) + theme(legend.position = "none")) +
#' (plot_guild_pq(subset_samples(d_fung_mini, Height == "High"),
#' levels_order = p$data$Guild[order(p$data$nb_seq)]
#' ) + ylab("") + theme(axis.text.y = element_blank()))
#' }
#' }
#' }
#' @seealso [add_funguild_info()]
plot_guild_pq <-
function(physeq,
levels_order = NULL,
clean_pq = TRUE,
...) {
if (clean_pq) {
physeq <- clean_pq(physeq, ...)
}
guilds <-
data.frame(sort(table(strsplit(
paste(
physeq@tax_table[, "guild"]
[physeq@tax_table[, "confidenceRanking"] %in%
c("Highly Probable", "Probable")],
collapse = "-"
),
split = "-"
))))
guilds$Var1 <- as.vector(guilds$Var1)
guilds <- guilds[guilds$Var1 != "NA", ]
guilds <- guilds[guilds$Var1 != "NULL", ]
guilds <- guilds[guilds$Var1 != "", ]
# Number of sequences per guild
nb_seq_by_guild <- c()
for (i in seq(1, length(guilds$Var1))) {
nb_seq_by_guild[i] <-
sum(taxa_sums(physeq@otu_table)[grepl(
guilds$Var1[i],
physeq@tax_table[, "guild"]
)])
}
names(nb_seq_by_guild) <- guilds$Var1
guilds$seq <- nb_seq_by_guild
names(guilds) <- c("Guild", "nb_asv", "nb_seq")
guilds$nb_seq <- as.numeric(guilds$nb_seq)
guilds$nb_asv <- as.numeric(guilds$nb_asv)
guilds$Guild <- factor(as.vector(guilds$Guild),
levels = guilds$Guild[order(guilds$nb_seq)]
)
COLORS <- rep("Others", nrow(guilds))
COLORS[grepl("Sapro", guilds$Guild)] <- "Sapro"
COLORS[grepl("Parasite", guilds$Guild)] <- "Parasite/pathogen"
COLORS[grepl("Pathog", guilds$Guild)] <- "Parasite/pathogen"
COLORS[grepl("ycorrh", guilds$Guild)] <- "Mutualist"
COLORS[grepl("Lichen", guilds$Guild)] <- "Mutualist"
COLORS[grepl("Endophy", guilds$Guild)] <- "Mutualist"
guilds$colors <- COLORS
guilds <- rbind(
guilds,
data.frame(
"Guild" = "All ASV",
"nb_asv" = ntaxa(physeq),
"nb_seq" = sum(physeq@otu_table),
"colors" = "ALL"
)
)
guilds <- guilds[order(guilds$nb_seq), ]
if (!is.null(levels_order)) {
guilds$Guild <- factor(guilds$Guild, levels = levels_order)
}
ggplot(
guilds,
aes(
y = Guild,
x = log10(nb_seq),
fill = colors
)
) +
geom_bar(stat = "identity") +
annotation_logticks(sides = "b", alpha = 0.5) +
ylab("GUILD by FUNGuild") +
scale_fill_manual("Guild",
values = c(
"gray", "Olivedrab", "cyan4", "tomato3",
"lightpink4"
)
) +
geom_text(aes(label = nb_asv, x = log10(nb_seq) + 0.2),
family = "serif"
) +
geom_text(aes(label = nb_seq, x = log10(nb_seq) / 2),
family = "mono",
col = "white"
)
}
################################################################################
################################################################################
#' Build phylogenetic trees from refseq slot of a phyloseq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' This function build tree phylogenetic tree and if nb_bootstrap is
#' set, it build also the 3 corresponding bootstrapped tree.
#'
#' Default parameters are based on \doi{doi:10.12688/f1000research.8986.2}
#' and phangorn vignette [Estimating phylogenetic trees with phangorn](https://klausvigo.github.io/phangorn/articles/Trees.html). You should understand your data, especially the markers,
#' before using this function.
#'
#' Note that phylogenetic reconstruction with markers used for metabarcoding are
#' not robust. You must verify the robustness of your phylogenetic tree using
#' taxonomic classification (see vignette [Tree visualization](https://adrientaudiere.github.io/MiscMetabar/articles/tree_visualization.html)) and bootstrap or multi-tree visualization
#'
#' @inheritParams clean_pq
#' @param nb_bootstrap (default 0): If a positive number is set,
#' the function also build 3 bootstrapped trees using `nb_bootstrap`
#' bootstrap samples
#' @param model allows to choose an amino acid models or nucleotide model,
#' see [phangorn::optim.pml()] for more details
#' @param optInv Logical value indicating whether topology gets optimized
#' (NNI). See [phangorn::optim.pml()] for more details
#' @param optGamma Logical value indicating whether gamma rate parameter gets
#' optimized. See [phangorn::optim.pml()] for more details
#' @param rearrangement type of tree tree rearrangements to perform, one of
#' "NNI", "stochastic" or "ratchet"
#' see [phangorn::optim.pml()] for more details
#' @param control A list of parameters for controlling the fitting process.
#' see [phangorn::optim.pml()] for more details
#' @param optNni Logical value indicating whether topology gets optimized (NNI).
#' see [phangorn::optim.pml()] for more details
#' @param multicore (logical) whether models should estimated in parallel.
#' see [phangorn::bootstrap.pml()] for more details
#' @param ... Other params for be passed on to
#' [phangorn::optim.pml()] function
#'
#' @return A list of phylogenetic tree
#' @export
#' @author Adrien Taudière
#' @details
#' This function is mainly a wrapper of the work of others.
#' Please make a reference to `phangorn` package if you
#' use this function.
#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"
#' \donttest{
#' if (requireNamespace("phangorn")) {
#' df <- subset_taxa_pq(data_fungi_mini, taxa_sums(data_fungi_mini) > 9000)
#' df_tree <- build_phytree_pq(df, nb_bootstrap = 2)
#' plot(df_tree$UPGMA)
#' phangorn::plotBS(df_tree$UPGMA, df_tree$UPGMA_bs, main = "UPGMA")
#' plot(df_tree$NJ, "unrooted")
#' plot(df_tree$ML)
#'
#' phangorn::plotBS(df_tree$ML$tree, df_tree$ML_bs, p = 20, frame = "circle")
#' phangorn::plotBS(
#' df_tree$ML$tree,
#' df_tree$ML_bs,
#' p = 20,
#' frame = "circle",
#' method = "TBE"
#' )
#' plot(phangorn::consensusNet(df_tree$ML_bs))
#' plot(phangorn::consensusNet(df_tree$NJ_bs))
#' ps_tree <- merge_phyloseq(df, df_tree$ML$tree)
#' }
#' }
build_phytree_pq <- function(physeq,
nb_bootstrap = 0,
model = "GTR",
optInv = TRUE,
optGamma = TRUE,
rearrangement = "NNI",
control = phangorn::pml.control(trace = 0),
optNni = TRUE,
multicore = FALSE,
...) {
seqs <- physeq@refseq
alignment <-
DECIPHER::AlignSeqs(Biostrings::DNAStringSet(seqs), anchor = NA)
phang.align <-
phangorn::phyDat(as(alignment, "matrix"), type = "DNA")
dm <- phangorn::dist.ml(phang.align)
treeNJ <- phangorn::NJ(dm) # Note, tip order != sequence order
treeUPGMA <-
phangorn::upgma(dm) # Note, tip order != sequence order
fit <- phangorn::pml(treeNJ, data = phang.align)
## negative edges length changed to 0!
fitGTR <- update(fit, k = 4, inv = 0.2)
tree_ML <-
phangorn::optim.pml(
fitGTR,
model = model,
optInv = optInv,
optGamma = optGamma,
rearrangement = rearrangement,
control = control,
optNni = optNni,
...
)
if (nb_bootstrap > 0) {
treeUPGMA_bs <-
phangorn::bootstrap.phyDat(phang.align,
function(x) {
phangorn::upgma(phangorn::dist.ml(x))
},
bs = nb_bootstrap
)
if (rearrangement == "NNI") {
tree_ML_bs <- phangorn::bootstrap.pml(
tree_ML,
bs = nb_bootstrap,
multicore = multicore,
rearrangement = "NNI",
...
)
} else if (rearrangement == "stochastic") {
tree_ML_bs <- phangorn::bootstrap.pml(
tree_ML,
bs = nb_bootstrap,
multicore = multicore,
rearrangement = "stochastic",
...
)
} else if (rearrangement == "ratchet") {
tree_ML_bs <- phangorn::bootstrap.pml(
tree_ML,
bs = nb_bootstrap,
multicore = multicore,
rearrangement = "ratchet",
...
)
} else {
stop("rearrangement parameter one of the three value 'stochastic',
'NNI' or 'ratchet'")
}
treeNJ_bs <- phangorn::bootstrap.phyDat(phang.align,
function(x) {
phangorn::NJ(phangorn::dist.ml(x))
},
bs = nb_bootstrap
)
return(
list(
"UPGMA" = treeUPGMA,
"NJ" = treeNJ,
"ML" = tree_ML,
"UPGMA_bs" = treeUPGMA_bs,
"NJ_bs" = treeNJ_bs,
"ML_bs" = tree_ML_bs
)
)
} else {
return(list(
"UPGMA" = treeUPGMA,
"NJ" = treeNJ,
"ML" = tree_ML
))
}
}
################################################################################
################################################################################
#' Test if the mean number of sequences by samples is link to the modality of
#' a factor
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' The aim of this function is to provide a warnings if samples depth significantly
#' vary among the modalities of a factor present in the `sam_data` slot.
#'
#' This function apply a Kruskal-Wallis rank sum test to the number of sequences
#' per samples in function of the factor `fact`.
#'
#' @inheritParams clean_pq
#' @param fact (required): Name of the factor to cluster samples by modalities.
#' Need to be in \code{physeq@sam_data}.
#' @param boxplot (logical) Do you want to plot boxplot?
#'
#' @return The result of a Kruskal-Wallis rank sum test
#' @export
#' @author Adrien Taudière
#' @importFrom stats kruskal.test
#' @examples
#'
#' are_modality_even_depth(data_fungi_mini, "Time")$p.value
#' are_modality_even_depth(rarefy_even_depth(data_fungi_mini), "Time")$p.value
#' are_modality_even_depth(data_fungi_mini, "Height", boxplot = TRUE)
are_modality_even_depth <- function(physeq, fact, boxplot = FALSE) {
nb_seq <- sample_sums(physeq)
fact <- factor(unclass(physeq@sam_data[, fact])[[1]])
res <- kruskal.test(nb_seq ~ fact)
if (boxplot) {
boxplot(nb_seq ~ fact)
}
if (length(unique(tapply(nb_seq, fact, mean))) == 1) {
message("All modality were undoubtedly rarefy in the physeq object.")
res$p.value <- 1
}
return(res)
}
################################################################################
################################################################################
#' Reorder taxa in otu_table/tax_table/refseq slot of a phyloseq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Note that the taxa order in a physeq object with a tree is locked by
#' the order of leaf in the phylogenetic tree.
#'
#' @inheritParams clean_pq
#' @param names_ordered (required): Names of the taxa (must be the same
#' as taxa in `taxa_names(physeq)`) in a given order
#' @param remove_phy_tree (logical, default FALSE) If TRUE, the phylogenetic
#' tree is removed. It is
#' @return A phyloseq object
#' @export
#' @author Adrien Taudière
#' @examples
#'
#' data_fungi_ordered_by_genus <- reorder_taxa_pq(
#' data_fungi,
#' taxa_names(data_fungi)[order(as.vector(data_fungi@tax_table[, "Genus"]))]
#' )
#'
#' data_fungi_mini_asc_ordered_by_abundance <- reorder_taxa_pq(
#' data_fungi_mini,
#' taxa_names(data_fungi_mini)[order(taxa_sums(data_fungi_mini))]
#' )
reorder_taxa_pq <- function(physeq, names_ordered, remove_phy_tree = FALSE) {
new_physeq <- physeq
if (!is.null(phy_tree(new_physeq, FALSE))) {
if (remove_phy_tree) {
message("Removing phylogenetic tree!")
new_physeq@phy_tree <- NULL
} else {
stop("The taxa order in a physeq object with a tree is locked by
the order of leaf in the phylogenetic tree. You could use args
remove_phy_tree = TRUE.")
}
}
if (sum(!names_ordered %in% taxa_names(new_physeq)) > 0) {
stop(
"The taxa names in physeq and in the args names_ordered are not the same.
You can try identify them usign match(names_ordered, taxa_names(physeq))"
)
}
order_taxa_names <- match(names_ordered, taxa_names(new_physeq))
if (!is.null(otu_table(new_physeq, FALSE))) {
if (taxa_are_rows(new_physeq)) {
new_physeq@otu_table <-
otu_table(new_physeq, taxa_are_rows = TRUE)[order_taxa_names, ]
} else {
new_physeq@otu_table <-
otu_table(new_physeq, taxa_are_rows = FALSE)[, order_taxa_names]
}
}
if (!is.null(tax_table(new_physeq, FALSE))) {
new_physeq@tax_table <-
tax_table(new_physeq)[order_taxa_names, ]
}
if (!is.null(refseq(new_physeq, FALSE))) {
new_physeq@refseq <-
refseq(new_physeq)[order_taxa_names]
}
return(new_physeq)
}
################################################################################
################################################################################
#' @title Add information to sample_data slot of a phyloseq-class object
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Warning: The value nb_seq and nb_otu may be outdated if you transform your
#' phyloseq object, e.g. using the [subset_taxa_pq()] function
#'
#' @inheritParams clean_pq
#' @param df_info : A dataframe with rownames matching for sample names of the
#' phyloseq object
#' @param add_nb_seq (Logical, default TRUE) Does we add a column nb_seq
#' collecting the number of sequences per sample?
#' @param add_nb_otu (Logical, default TRUE) Does we add a column nb_otu
#' collecting the number of OTUs per sample?
#'
#' @return A phyloseq object with an updated sam_data slot
#' @export
#'
#' @examples
#'
#' data_fungi <- add_info_to_sam_data(data_fungi)
#' boxplot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$Time)
#'
#' new_df <- data.frame(
#' variable_1 = runif(n = nsamples(data_fungi), min = 1, max = 20),
#' variable_2 = runif(n = nsamples(data_fungi), min = 1, max = 2)
#' )
#' rownames(new_df) <- sample_names(data_fungi)
#' data_fungi <- add_info_to_sam_data(data_fungi, new_df)
#' plot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$variable_1)
#' @author Adrien Taudière
add_info_to_sam_data <- function(physeq,
df_info = NULL,
add_nb_seq = TRUE,
add_nb_otu = TRUE) {
if (add_nb_seq) {
physeq@sam_data$nb_seq <- sample_sums(physeq)
}
if (add_nb_otu) {
physeq@sam_data$nb_otu <- sample_sums(as_binary_otu_table(physeq))
}
if (!is.null(df_info)) {
if (sum(sample_names(physeq) %in% rownames(df_info)) == 0) {
stop("Rownames of df_info must match the sample names of physeq.")
}
df_info <-
df_info[match(sample_names(physeq), rownames(df_info)), ]
physeq@sam_data <- sample_data(cbind(
as.data.frame(physeq@sam_data),
df_info
))
}
return(physeq)
}
################################################################################
###############################################################################
#' Return a DNAStringSet object from either a character vector of DNA sequences
#' or the `refseq` slot of a phyloseq-class object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-stable-green" alt="lifecycle-stable"></a>
#'
#' Internally used in [vsearch_clustering()], [swarm_clustering()] and
#' [asv2otu()].
#'
#' @inheritParams clean_pq
#' @param dna_seq You may directly use a character vector of DNA sequences
#' in place of physeq args. When physeq is set, dna sequences take the value
#' of `physeq@refseq`
#'
#' @return An object of class DNAStringSet (see the [Biostrings::DNAStringSet()]
#' function)
#' @export
#'
#' @examples
#'
#' dna <- physeq_or_string_to_dna(data_fungi)
#' dna
#'
#' sequences_ex <- c(
#' "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
#' "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
#' "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
#' "TACCTATGTTGCCTTGGCGGCTAAACCTACC",
#' "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
#' "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
#' "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
#' "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
#' "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
#' )
#' dna2 <- physeq_or_string_to_dna(dna_seq = sequences_ex)
#' dna2
#'
#' @seealso [Biostrings::DNAStringSet()]
#' @author Adrien Taudière
physeq_or_string_to_dna <- function(physeq = NULL,
dna_seq = NULL) {
if (inherits(physeq, "phyloseq")) {
verify_pq(physeq)
if (is.null(physeq@refseq)) {
stop("The phyloseq object do not contain a @refseq slot")
}
dna <- Biostrings::DNAStringSet(physeq@refseq)
if (!is.null(dna_seq)) {
stop("You must use either physeq or dna_seq args but not both")
}
} else if (inherits(dna_seq, "character")) {
dna <- Biostrings::DNAStringSet(dna_seq)
} else {
stop(
"You must set the args physeq (object of class phyloseq) or
dna_seq (character vector)."
)
}
return(dna)
}
###############################################################################
################################################################################
#' Remove primers using [cutadapt](https://github.com/marcelm/cutadapt/)
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' You need to install [Cutadapt](https://cutadapt.readthedocs.io/).
#' See also https://github.com/VascoElbrecht/JAMP/blob/master/JAMP/R/Cutadapt.R for another call to cutadapt
#' from R
#'
#' @param path_to_fastq (Required) A path to a folder with fastq files. See
#' [list_fastq_files()] for help.
#' @inheritParams list_fastq_files
#' @param primer_fw (Required, String) The forward primer DNA sequence.
#' @param primer_rev (String) The reverse primer DNA sequence.
#' @param folder_output The path to a folder for output files
#' @param nproc (default 1)
#' Set to number of cpus/processors to use for the clustering
#' @param cmd_is_run (logical, default TRUE) Do the cutadapt command is run.
#' If set to FALSE, the only effect of the function is to return a list of
#' command to manually run in a terminal.
#' @param args_before_cutadapt (String) A one line bash command to run before
#' to run cutadapt. For examples, "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv &&" allow to bypass the conda init which asks to restart the shell
#'
#' @return a list of command
#' @export
#' @author Adrien Taudière
#'
#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"
#' \dontrun{
#' cutadapt_remove_primers("inst/extdata", "TTC", "GAA",
#' folder_output = tempdir()
#' )
#'
#' cutadapt_remove_primers(
#' system.file("extdata",
#' package = "dada2"
#' ),
#' pattern_R1 = "F.fastq.gz",
#' pattern_R2 = "R.fastq.gz",
#' primer_fw = "TTC",
#' primer_rev = "GAA",
#' folder_output = tempdir()
#' )
#'
#' cutadapt_remove_primers(
#' system.file("extdata",
#' package = "dada2"
#' ),
#' pattern_R1 = "F.fastq.gz",
#' primer_fw = "TTC",
#' folder_output = tempdir(),
#' cmd_is_run = FALSE
#' )
#'
#' unlink(tempdir(), recursive = TRUE)
#' }
#' @details
#' This function is mainly a wrapper of the work of others.
#' Please cite cutadapt (\doi{doi:10.14806/ej.17.1.200}).
cutadapt_remove_primers <- function(path_to_fastq,
primer_fw = NULL,
primer_rev = NULL,
folder_output = "wo_primers",
nproc = 1,
pattern = "fastq.gz",
pattern_R1 = "_R1",
pattern_R2 = "_R2",
nb_files = Inf,
cmd_is_run = TRUE,
args_before_cutadapt = "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv && ") {
cmd <- list()
if (!dir.exists(folder_output)) {
dir.create(folder_output)
}
if (is.null(primer_rev)) {
lff <- list_fastq_files(
path_to_fastq,
paired_end = FALSE,
pattern = pattern,
pattern_R1 = pattern_R1,
pattern_R2 = pattern_R2,
nb_files = nb_files
)
for (f in lff$fnfs) {
cmd[[f]] <-
paste0(
args_before_cutadapt,
"cutadapt --cores=",
nproc,
" --discard-untrimmed -g '",
primer_fw,
"' -o ",
folder_output,
"/",
basename(f),
" ",
f
)
}
} else {
lff <- list_fastq_files(path_to_fastq,
paired_end = TRUE,
pattern = pattern,
pattern_R1 = pattern_R1,
pattern_R2 = pattern_R2,
nb_files = nb_files
)
primer_fw_RC <- dada2::rc(primer_fw)
primer_rev_RC <- dada2::rc(primer_rev)
for (f in lff$fnfs) {
cmd[[f]] <-
paste0(
args_before_cutadapt,
"cutadapt -n 2 --cores=",
nproc,
" --discard-untrimmed -g '",
primer_fw,
"' -G '",
primer_rev,
"' -a '",
primer_rev_RC,
"' -A '",
primer_fw_RC,
"' -o ",
folder_output,
"/",
basename(f),
" -p ",
folder_output,
"/",
gsub(pattern_R1, pattern_R2, basename(f)),
" ",
f,
" ",
gsub(pattern_R1, pattern_R2, f)
)
}
}
if (cmd_is_run) {
writeLines(unlist(cmd), paste0(tempdir(), "/script_cutadapt.sh"))
system2("bash", paste0(tempdir(), "/script_cutadapt.sh"))
message(paste0("Output files are available in the folder ", normalizePath(folder_output)))
unlink(paste0(tempdir(), "/script_cutadapt.sh"))
}
return(cmd)
}
################################################################################
################################################################################
#' List the taxa founded only in one given level of a modality
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Given one modality name in sam_data and one level of the modality,
#' return the taxa strictly specific of this level.
#'
#' @inheritParams clean_pq
#' @param modality (required) The name of a column present in the `@sam_data` slot
#' of the physeq object. Must be a character vector or a factor.
#' @param level (required) The level (must be present in modality) of interest
#' @param min_nb_seq_taxa (default 0 = no filter) The minimum number of sequences per taxa
#' @param min_nb_samples_taxa (default 0 = no filter) The minimum number of samples per taxa
#'
#' @return A vector of taxa names
#' @export
#'
#' @examples
#' # Taxa present only in low height samples
#' suppressMessages(suppressWarnings(taxa_only_in_one_level(data_fungi, "Height", "Low")))
#' # Number of taxa present only in sample of time equal to 15
#' suppressMessages(suppressWarnings(length(taxa_only_in_one_level(data_fungi, "Time", "15"))))
#' @seealso [ggvenn_pq()] and [upset_pq()]
#' @export
#' @author Adrien Taudière
taxa_only_in_one_level <- function(physeq,
modality,
level,
min_nb_seq_taxa = 0,
min_nb_samples_taxa = 0) {
if (min_nb_seq_taxa > 0) {
physeq <-
subset_taxa_pq(physeq, taxa_sums(physeq) >= min_nb_seq_taxa)
}
if (min_nb_samples_taxa > 0) {
physeq <-
subset_taxa_pq(
physeq,
taxa_sums(as_binary_otu_table(physeq)) >= min_nb_samples_taxa
)
}
physeq_merged <- clean_pq(merge_samples2(physeq, modality))
physeq_merged_only_one_level <-
subset_taxa_pq(physeq_merged, taxa_sums(as_binary_otu_table(physeq_merged)) ==
1)
physeq_merged_only_level_given <-
clean_pq(subset_samples_pq(
physeq_merged_only_one_level,
rownames(physeq_merged_only_one_level@sam_data) == level
))
return(taxa_names(physeq_merged_only_level_given))
}
################################################################################
################################################################################
#' Normalize OTU table using samples depth
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' This function implement the method proposed by
#' McKnight et al. 2018 (\doi{doi:10.5061/dryad.tn8qs35})
#'
#' @inheritParams clean_pq
#'
#' @param base_log (integer, default 2) the base for log-transformation. If
#' set to NULL or NA, no log-transformation is compute after normalization.
#' @param constante a constante to multiply the otu_table values
#' @param digits (default = 2) integer indicating the number of decimal places
#' to be used (see `?round` for more information)
#'
#' @return A new \code{\link{phyloseq-class}} object with otu_table count
#' normalize and log transformed (if base_log is an integer)
#' @export
#' @author Adrien Taudière
#' @examples
#' taxa_sums(data_fungi_mini)
#' data_f_norm <- normalize_prop_pq(data_fungi_mini)
#' taxa_sums(data_f_norm)
#' ggplot(data.frame(
#' "norm" = scale(taxa_sums(data_f_norm)),
#' "raw" = scale(taxa_sums(data_fungi_mini)),
#' "name_otu" = taxa_names(data_f_norm)
#' )) +
#' geom_point(aes(x = raw, y = norm))
#'
#' data_f_norm <- normalize_prop_pq(data_fungi_mini, base_log = NULL)
normalize_prop_pq <- function(physeq, base_log = 2, constante = 10000, digits = 4) {
verify_pq(physeq)
if (taxa_are_rows(physeq)) {
new_otutab <- round((apply(physeq@otu_table, 2, function(x) {
x / sum(x)
})) * constante, digits = digits)
} else {
new_otutab <- round((apply(physeq@otu_table, 1, function(x) {
x / sum(x)
})) * constante, digits = digits)
}
if (!is.null(base_log) && !is.na(base_log)) {
new_otutab <- round(log(new_otutab + 1, base = base_log), digits = digits)
}
new_physeq <- physeq
new_physeq@otu_table <- otu_table(new_otutab, taxa_are_rows = taxa_are_rows(physeq))
return(new_physeq)
}
################################################################################
################################################################################
#' Build a sample information tibble from physeq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' Hill numbers are the number of equiprobable species giving the same diversity
#' value as the observed distribution.
#'
#' Note that contrary to [hill_pq()], this function does not take into
#' account for difference in the number of sequences per samples/modalities.
#' You may use rarefy_by_sample = TRUE if the mean number of sequences per
#' samples differs among modalities.
#' @inheritParams clean_pq
#' @param hill_scales (a vector of integer) The list of q values to compute
#' the hill number H^q. If Null, no hill number are computed. Default value
#' compute the Hill number 0 (Species richness), the Hill number 1
#' (exponential of Shannon Index) and the Hill number 2 (inverse of Simpson
#' Index).
#' @param filter_zero (logical, default TRUE) Do we filter non present OTU from
#' samples ? For the moment, this has no effect on the result because the dataframe
#' is grouped by samples with abundance summed across OTU.
#' @param rarefy_by_sample (logical, default FALSE) If TRUE, rarefy
#' samples using [phyloseq::rarefy_even_depth()] function.
#' @param taxa_ranks A vector of taxonomic ranks. For examples c("Family","Genus").
#' If taxa ranks is not set (default value = NULL), taxonomic information are not
#' present in the resulting tibble.
#' @author Adrien Taudière
#' @export
#' @return A tibble with a row for each sample. Columns provide information
#' from `sam_data` slot as well as hill numbers, Abundance (nb of sequences),
#' and Abundance_log10 (*log10(1+Abundance)*).
#' @examples
#' if (requireNamespace("ggstatsplot")) {
#' psm_tib <- psmelt_samples_pq(data_fungi_mini, hill_scales = c(0, 2, 7))
#' ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_0)
#' ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_7)
#'
#' psm_tib_tax <- psmelt_samples_pq(data_fungi_mini, taxa_ranks = c("Class", "Family"))
#' ggplot(filter(psm_tib_tax, Abundance > 2000), aes(y = Family, x = Abundance, fill = Time)) +
#' geom_bar(stat = "identity") +
#' facet_wrap(~Height)
#' }
psmelt_samples_pq <-
function(physeq,
hill_scales = c(0, 1, 2),
filter_zero = TRUE,
rarefy_by_sample = FALSE,
taxa_ranks = NULL) {
verify_pq(physeq)
if (rarefy_by_sample) {
physeq <- rarefy_even_depth(physeq)
}
psm <- psmelt(physeq)
if (filter_zero) {
psm <- psm |> filter(Abundance > 0)
}
if (is.null(taxa_ranks)) {
psm <- psm |>
select(Sample, OTU, Abundance, colnames(physeq@sam_data))
nb_distinct_samp <- psm |>
group_by(Sample) |>
select(-OTU, -Abundance) |>
distinct() |>
nrow()
if (nsamples(physeq) != nb_distinct_samp) {
stop("The number of samples in physeq is different from the resulting
number in psm tibble.")
}
} else {
psm <- psm |>
select(Sample, OTU, Abundance, colnames(physeq@sam_data), !!taxa_ranks)
}
if (is.null(taxa_ranks)) {
psm_samp <- psm |>
select(-OTU) |>
group_by(Sample) |>
summarise(
Abundance = sum(Abundance),
across(where(is.numeric) &
!Abundance, ~ mean(.x, na.rm = TRUE)),
across(where(is.character), ~ .x[1])
)
} else {
psm_temp <- psm |>
select(-OTU) |>
group_by(Sample)
for (i in seq_along(taxa_ranks)) {
psm_temp <- psm_temp |>
group_by(.data[[taxa_ranks[[i]]]], .add = TRUE)
}
psm_samp <- psm_temp |>
summarise(
Abundance = sum(Abundance),
across(where(is.numeric) &
!Abundance, ~ mean(.x, na.rm = TRUE)),
across(where(is.character), ~ .x[1]),
.groups = "drop"
)
}
if (!is.null(hill_scales)) {
physeq <- taxa_as_rows(physeq)
df_hill <-
vegan::renyi(t(physeq)@otu_table,
scales = hill_scales,
hill = TRUE
)
colnames(df_hill) <- paste0("Hill_", hill_scales)
df_hill$Sample <- rownames(df_hill)
psm_samp <- full_join(psm_samp, df_hill)
}
psm_samp <- psm_samp |> mutate(Abundance_log10 = log10(1 + Abundance))
return(tibble(psm_samp))
}
################################################################################
################################################################################
#' Force taxa to be in columns in the otu_table of a physeq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' Mainly for internal use. It is a special case of clean_pq function.
#'
#' @inheritParams clean_pq
#' @author Adrien Taudière
#' @export
#' @return A new \code{\link{phyloseq-class}} object
taxa_as_columns <- function(physeq) {
physeq <- clean_pq(
physeq,
clean_samples_names = FALSE,
remove_empty_samples = FALSE,
remove_empty_taxa = FALSE,
force_taxa_as_columns = TRUE,
silent = TRUE
)
return(physeq)
}
################################################################################
################################################################################
#' Force taxa to be in columns in the otu_table of a physeq object
#'
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-maturing-blue" alt="lifecycle-maturing"></a>
#'
#' Mainly for internal use. It is a special case of clean_pq function.
#'
#' @inheritParams clean_pq
#' @author Adrien Taudière
#' @export
#' @return A new \code{\link{phyloseq-class}} object
taxa_as_rows <- function(physeq) {
physeq <- clean_pq(
physeq,
clean_samples_names = FALSE,
remove_empty_samples = FALSE,
remove_empty_taxa = FALSE,
force_taxa_as_rows = TRUE,
silent = TRUE
)
return(physeq)
}
################################################################################
################################################################################
#' Rarefy (equalize) the number of samples per modality of a factor
#' @description
#'
#' <a href="https://adrientaudiere.github.io/MiscMetabar/articles/Rules.html#lifecycle">
#' <img src="https://img.shields.io/badge/lifecycle-experimental-orange" alt="lifecycle-experimental"></a>
#'
#' This function randomly draw the same number of samples for each modality of factor.
#' It is usefull to dissentangle the effect of different number of samples per modality
#' on diversity. Internally used in [accu_plot_balanced_modality()].
#'
#' @inheritParams clean_pq
#' @param fact (required): The variable to rarefy. Must be present in
#' the `sam_data` slot of the physeq object.
#' @param rngseed (Optional). A single integer value passed to set.seed,
#' which is used to fix a seed for reproducibly random number generation
#' (in this case, reproducibly random subsampling). If set to FALSE, then no
#' iddling with the RNG seed is performed, and it is up to the user to
#' appropriately call
#' @param verbose (logical). If TRUE, print additional informations.
#' @export
#' @author Adrien Taudière
#' @return A new \code{\link{phyloseq-class}} object.
#' @seealso [accu_plot_balanced_modality()]
#' @examples
#' table(data_fungi_mini@sam_data$Height)
#' data_fungi_mini2 <- rarefy_sample_count_by_modality(data_fungi_mini, "Height")
#' table(data_fungi_mini2@sam_data$Height)
#' if (requireNamespace("patchwork")) {
#' ggvenn_pq(data_fungi_mini, "Height") + ggvenn_pq(data_fungi_mini2, "Height")
#' }
rarefy_sample_count_by_modality <-
function(physeq, fact, rngseed = FALSE, verbose = TRUE) {
if (as(rngseed, "logical")) {
set.seed(rngseed)
if (verbose) {
message("`set.seed(", rngseed, ")` was used to initialize repeatable random subsampling.")
message("Please record this for your records so others can reproduce.")
message("Try `set.seed(", rngseed, "); .Random.seed` for the full vector",
sep = ""
)
message("...")
}
} else if (verbose) {
message(
"You set `rngseed` to FALSE. Make sure you've set & recorded\n",
" the random seed of your session for reproducibility.\n",
"See `?set.seed`\n"
)
message("...")
}
mod <- as.factor(physeq@sam_data[[fact]])
n_mod <- table(mod)
samples_names <- sample_names(physeq)
samp_to_keep <- c()
for (modality in levels(mod)) {
vec_samp_mod <- c(as.numeric(grep(modality, mod)))
# To bypass the pb of vector of length 1
# We build a vector of two equal values and we will take only one
# It is cause by range base behavior:
# 'If x has length 1, is numeric (in the sense of is.numeric) and x >= 1, sampling via sample takes place from 1:x.'
if (length(vec_samp_mod) == 1) {
vec_samp_mod <- c(vec_samp_mod, vec_samp_mod)
}
samp_to_keep <-
c(
samp_to_keep,
sample(
vec_samp_mod,
size = min(n_mod),
replace = FALSE
)
)
}
new_physeq <-
subset_samples_pq(physeq, 1:nsamples(physeq) %in% samp_to_keep)
if (length(table(new_physeq@sam_data[[fact]])) != length(table(mod))) {
warning(
paste0(
"The number of final levels (sam_data of the output phyloseq
object) is not equal to the inital (sam_data of the input
phyloseq object) number of levels in the factor: '",
fact, "'"
)
)
}
return(new_physeq)
}
################################################################################
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.