MultiAmplicon-class: The central data structure of the MultiAmplicon package

Description Usage Arguments Functions Slots Author(s) See Also Examples

Description

The MultiAmplicon class is a container that stores at least primer pairs, read files and progressively processed data in an 'amplicon x samples' format. The slots in this object are incrementally filled with by running wrappers functions (mostly around functions from the dada2 package).

Subsetting for MultiAmplicon objects should conveniently subset all (potentially) filled slots

Usage

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
MultiAmplicon(PrimerPairsSet = PrimerPairsSet(),
  PairedReadFileSet = PairedReadFileSet(), rawCounts = matrix(),
  stratifiedFiles = list(), derep = list(), dada = list(),
  mergers = list(), sequenceTable = list(),
  sequenceTableNoChime = list(), taxonTable = list())

## S4 method for signature 'MultiAmplicon'
colnames(x)

## S4 method for signature 'MultiAmplicon'
rownames(x)

## S4 method for signature 'MultiAmplicon'
ncol(x)

## S4 method for signature 'MultiAmplicon'
nrow(x)

## S4 method for signature 'MultiAmplicon'
dim(x)

getRawCounts(MA)

getStratifiedFilesF(MA, simplify = TRUE)

getStratifiedFilesR(MA, simplify = TRUE)

getDerepF(MA, simplify = TRUE)

getDerepR(MA, simplify = TRUE)

getDadaF(MA, simplify = TRUE)

getDadaR(MA, simplify = TRUE)

getMergers(MA, simplify = TRUE)

getSequenceTable(MA, simplify = TRUE)

getSequenceTableNoChime(MA, simplify = TRUE)

getSequencesFromTable(MA)

## S4 method for signature 'MultiAmplicon'
getSequencesFromTable(MA)

## S4 method for signature 'MultiAmplicon'
show(object)

## S4 method for signature 'MultiAmplicon,index,index,ANY'
x[i, j, ..., drop = FALSE]

## S4 method for signature 'MultiAmplicon,index,missing,ANY'
x[i, j, ..., drop = FALSE]

## S4 method for signature 'MultiAmplicon,missing,index,ANY'
x[i, j, ..., drop = FALSE]

## S4 method for signature 'MultiAmplicon,missing,missing,ANY'
x[i, j, ...,
  drop = FALSE]

Arguments

PrimerPairsSet

a set of primer pairs specifiying your amplicons see PrimerPairsSet-class

PairedReadFileSet

a set of paired end sequencing data files PairedReadFileSet-class

rawCounts

Users should not supply this parameter, the slot is created by sortAmplicons.

stratifiedFiles

Users should not supply this parameter, the slot is created by sortAmplicons.

derep

Users should not supply this parameter, the slot is created by derepMulti

dada

Users should not supply this parameter, the slot is created by dadaMulti

mergers

Users should not supply this parameter, the slot is created by mergeMulti

sequenceTable

Users should not supply this parameter, the slot is created by makeSequenceTableMulti

sequenceTableNoChime

Users should not supply this parameter, the slot is created by removeChimeraMulti

taxonTable

Users should not supply this parameter, the slot is created by getBlastTaxAnnot

x

MultiAmplicon-class object

MA

MultiAmplicon-class object

simplify

Should a list of objects be simplified to only one object if it has length one?

object

A MultiAmplicon-class object.

i

numeric, logical or names vector for subsetting rows (== amplicons)

j

numeric, logical or names vector for subsetting columns (== read files, corresponding usually to samples)

...

not used

drop

should not be used

Functions

Slots

PrimerPairsSet

The primer pairs used in your experiment to specify amplicons stored in a PrimerPairsSet-class object.

PairedReadFileSet

The (quality filtered) fastq files (one file pair for each sample) that store your sequencing data.

rawCounts

A numeric matrix of sequencing read counts per amplicon and sample. Created by the function sortAmplicons

stratifiedFiles

temporary files as a result of stratifying into amplicons and samples using the function sortAmplicons. Forward (sometimes called R1) and reverse (sometimes called R2) files are stored as a (amplicons x samples) matrix of PairedReadFileSet-class objects.

derep

A PairedDerep-class object containing pairs of derep-class objects created by dada2’s derepFastq function

dada

A PairedDada-class object containing pairs of dada-class objects created by dada2’s dada function

mergers
sequenceTable
sequenceTableNoChime
taxonTable

MultiAmplicon(PrimerPairsSet, PairedReadFileSet)

Author(s)

Emanuel Heitlinger

See Also

derepFastq,dada

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
primerF <- c("AGAGTTTGATCCTGGCTCAG", "ACTCCTACGGGAGGCAGC",
            "GAATTGACGGAAGGGCACC", "YGGTGRTGCATGGCCGYT")
primerR <- c("CTGCWGCCNCCCGTAGG", "GACTACHVGGGTATCTAATCC",
             "AAGGGCATCACAGACCTGTTAT", "TCCTTCTGCAGGTTCACCTAC")

PPS <- PrimerPairsSet(primerF, primerR)

fastq.dir <- system.file("extdata", "fastq", package = "MultiAmplicon")
fastq.files <- list.files(fastq.dir, full.names=TRUE)
Ffastq.file <- fastq.files[grepl("F_filt", fastq.files)]
Rfastq.file <- fastq.files[grepl("R_filt", fastq.files)]

PRF <- PairedReadFileSet(Ffastq.file, Rfastq.file)

MA <- MultiAmplicon(PPS, PRF)

## the number of amplicons (primer pairs)
nrow(MA)

## the number of samples (sequencing read file pairs)
ncol(MA)

## sort into amplicons
MA1 <- sortAmplicons(MA, filedir=tempfile(pattern = "dir"))

MA2 <- derepMulti(MA1)

MA3 <- dadaMulti(MA2, selfConsist = TRUE)

MA4 <- mergeMulti(MA3, justConcatenate=TRUE)

MA5 <- makeSequenceTableMulti(MA4)

MA6 <- removeChimeraMulti(MA5, mc.cores=1)

MA7 <- getBlastTaxAnnot(MA6)

derele/MultiAmplicon documentation built on May 15, 2019, 5:04 a.m.