Description Usage Arguments Details Value Author(s) See Also Examples
CodonUsage calculates ratio of optimal codons used to the sum of synonymous codons
1 | CodonUsage(cdslist = mylist())
|
cdslist |
List of coding sequences in reading frame (eg. of full genome), handles also DNA string sequences. |
Creates a count table to decide on optimality of codons based on the usage of the imput DNA sequences.
data frame with codon usage count Table with statistics for optimality based on occurence
Siegrist, F. and Cannarozzi, G. M. gina@cannarozzi.com
1 2 | CodonUsage('ATGTGGTACTCCGACTACGGAGGATAA')
CodonUsage(mylist(whatout=1))
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.