Description Usage Arguments Details Value Author(s) See Also Examples
ComputeGC3syn Computes the G+C content at the 1st and 2nd position of synonymous codons
1 | ComputeGC12syn(tD)
|
tD |
Nucleotide character string |
Computes the GC content of the 1st and 2nd position of synonymous codons to estimate the background GC content when compared with the GC content at the 3rd position. By definition, GC12s values are the proportion of GC nucleotides at the fixed first and less variable second coding position of synonymous codons. This can be used to evaluate the degree of base composition bias.
vector of (o/n)first (o/n)second
Siegrist, F. and Cannarozzi, G. M. gina@cannarozzi.com
seqinr statanacoseq ComputeGC3syn
1 2 | ComputeGC12syn('ATGTGGTACTCCGACTACGGAGGATAA')
plot(mean(ComputeGC12syn(toupper(c2s(mylist(whatout=1)[[1]])))), ComputeGC3syn(toupper(c2s(mylist(whatout=1)[[1]]))))
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.